Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-410-3p URS000047E765_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, TarBase, MirGeneDB, ENA, PirBase, LncBase, miRBase). Mus musculus (house mouse) mmu-miR-410-3p sequence is a product of mmu-miR-410-3p, Mir410, miR-410, miR-410-3p, mmu-miR-410 genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1110020G17Rik, 1200003E16Rik, 1500001E21Rik, Aff4, Alf4, C130026I10Rik, Calm2, DAP-5, DLK, Dirc2.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAUAUAACACAGAUGGCCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 23 other species

    1. Bos taurus bta-miR-410
    2. Callithrix jacchus cja-miR-410
    3. Canis lupus familiaris cfa-miR-410
    4. Capra hircus chi-miR-410-3p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-410-3p
    6. Cervus elaphus (red deer) cel-miR-410
    7. Cricetulus griseus cgr-miR-410-3p
    8. Dasypus novemcinctus dno-miR-410-3p
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P12_3p (mature (guide))
    10. Equus caballus (horse) eca-miR-410
    11. Homo sapiens (human) hsa-miR-410-3p
    12. Macaca mulatta (Rhesus monkey) mml-miR-410-3p
    13. Microcebus murinus (gray mouse lemur) mmr-miR-410
    14. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-410
    15. Oryctolagus cuniculus ocu-miR-410-3p
    16. Otolemur garnettii (small-eared galago) oga-miR-410
    17. Ovis aries (sheep) oar-miR-410-3p
    18. Pan paniscus ppa-miR-410
    19. Pan troglodytes ptr-miR-410
    20. Pongo pygmaeus (Bornean orangutan) ppy-miR-410
    21. Pteropus alecto pal-miR-410-3p
    22. Rattus norvegicus (Norway rat) rno-miR-410-3p
    23. Sus scrofa (pig) ssc-mir258
    Publications New