Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ovis aries tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1) secondary structure diagram

Ovis aries tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1) URS000047C79B_9940

Automated summary: This ncRNA sequence is 72 nucleotides long and is found in Ovis aries. Annotated by 1 database (GeneCards). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Ovis aries tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1) sequence is a product of tRNA-Ala-AGC-1-1 gene. Found in the sheep reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGGGGUGUAGCUCAGUGGUAGAGCGCGUGCUUAGCAUGUACGAGGUCCCGGGUUCAAUCCCCGGCACCUCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Ailuropoda melanoleuca tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-4-1)
    2. Balaenoptera acutorostrata scammoni tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1)
    3. Bos taurus tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1)
    4. Callithrix jacchus tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-3-1)
    5. Canis lupus familiaris tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-3-1)
    6. Carlito syrichta tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1)
    7. Ceratotherium simum simum tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1)
    8. Chlorocebus sabaeus tRNA
    9. Equus caballus tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1)
    10. Felis catus tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-2-1)
    11. Gorilla gorilla gorilla tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1, tRNA-Ala-AGC-5-1)
    12. Homo sapiens tRNA-Ala (anticodon AGC) 3-1
    13. Loxodonta africana tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-2-1)
    14. Macaca mulatta tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-5-1)
    15. Mustela putorius furo tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-2-1)
    16. Nomascus leucogenys tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-3-1)
    17. Pan troglodytes tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-5-1)
    18. Papio anubis tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-6-1)
    19. Pongo abelii tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-4-1)
    20. Procavia capensis tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-3-1)
    21. Saimiri boliviensis boliviensis tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-4-1)
    22. Sus scrofa tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-2-1)
    23. Tursiops truncatus tRNA Alanine with anticodon AGC (tRNA-Ala-AGC-1-1)
    2D structure New