Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca mulatta tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1) secondary structure diagram

Macaca mulatta tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1) URS000047C79B_9544

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Macaca mulatta. Annotated by 2 databases (GtRNAdb, Rfam). Described in 5 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Macaca mulatta tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1) sequence is a product of tRNA-Ala-AGC-5-1 gene. Found in the rhesus monkey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGGGGUGUAGCUCAGUGGUAGAGCGCGUGCUUAGCAUGUACGAGGUCCCGGGUUCAAUCCCCGGCACCUCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    2D structure New