Drosophila simulans (Fruit fly) pre miRNA Dsim\mir-305

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila simulans (Fruit fly) pre miRNA Dsim\mir-305 URS000047AFFA_7240

73 nucleotides
1 database (Ensembl Metazoa)
Found in 2 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CAUGUCUAUUGUACUUCAUCAGGUGCUCUGGUGUGUCUCGUAACCCGGCACAUGUUGAAGUACACUCAAUAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Drosophila melanogaster microRNA dme-mir-305 precursor
Drosophila sechellia microRNA dse-mir-305 precursor