Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila simulans pre miRNA Dsim\mir-305 secondary structure diagram

Drosophila simulans pre miRNA Dsim\mir-305 URS000047AFFA_7240

Automated summary: This pre miRNA sequence is 73 nucleotides long and is found in Drosophila simulans. Annotated by 1 database (Ensembl Metazoa). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-305, RF00732). Drosophila simulans pre miRNA Dsim\mir-305 sequence is a product of FBgn0255943 gene. Found in the Drosophila simulans reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAUGUCUAUUGUACUUCAUCAGGUGCUCUGGUGUGUCUCGUAACCCGGCACAUGUUGAAGUACACUCAAUAUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 1 other species

    1. Drosophila melanogaster microRNA dme-mir-305 precursor
    2. Drosophila sechellia microRNA dse-mir-305 precursor
    2D structure New