Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-103-3p URS0000476BE1_9544

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Macaca mulatta. Annotated by 4 databases (RefSeq, MirGeneDB, miRBase, ENA). Described in 8 papers. Macaca mulatta (Rhesus monkey) mml-miR-103-3p sequence is a product of mml-miR-103-3p, MIR103-1, MIR103-2, miR-103-3p, mml-miR-103, mir-103-1, miR-103, 103-1 genes. Found in the rhesus monkey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCAGCAUUGUACAGGGCUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 58 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-103-P1_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-103-P2_3p (mature (guide))
    3. Ateles geoffroyi age-miR-103
    4. Bos taurus bta-miR-103
    5. Callorhinchus milii (elephant shark) eshark_mir-103_2
    6. Canis lupus familiaris cfa-miR-103
    7. Capra hircus (goat) chi-miR-103-3p
    8. Cavia porcellus cpo-miR-103-3p
    9. Cervus elaphus (red deer) cel-miR-103
    10. Chiloscyllium plagiosum microRNA cpl-miR-103
    11. Chrysemys picta bellii Cpi-Mir-103-P2_3p (mature (guide))
    12. Columba livia cli-miR-103-3p
    13. Cricetulus griseus cgr-miR-103-3p
    14. Cyprinus carpio ccr-miR-103
    15. Danio rerio (zebrafish) dre-miR-103
    16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-103a-3p
    17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-103-P2_3p (mature (guide))
    18. Equus caballus eca-miR-107a
    19. Gadus morhua (Atlantic cod) gmo-miR-103-3p
    20. Gallus gallus (chicken) gga-miR-103-3p
    21. Gorilla gorilla ggo-miR-103
    22. Haplochromis burtoni abu-miR-103
    23. Homo sapiens hsa-miR-103a-3p
    24. Ictalurus punctatus ipu-miR-103
    25. Ictidomys tridecemlineatus microRNA miR-103
    26. Lagothrix lagotricha lla-miR-103
    27. Macaca nemestrina mne-miR-103
    28. Maylandia zebra (zebra mbuna) mze-miR-103
    29. Microcebus murinus mmr-miR-103a
    30. Monodelphis domestica mdo-miR-103-3p
    31. Mus musculus mmu-miR-103-3p
    32. Neolamprologus brichardi nbr-miR-103
    33. Nomascus leucogenys nle-miR-103a
    34. Ophiophagus hannah (king cobra) oha-miR-103b-3p
    35. Oreochromis niloticus (Nile tilapia) oni-miR-103
    36. Ornithorhynchus anatinus oan-miR-103-3p
    37. Oryctolagus cuniculus (rabbit) ocu-miR-103a-3p
    38. Otolemur garnettii (small-eared galago) oga-miR-103b
    39. Ovis aries (sheep) miscellaneous RNA
    40. Pan paniscus ppa-miR-103
    41. Pan troglodytes ptr-miR-103
    42. Papio hamadryas (hamadryas baboon) pha-miR-103b
    43. Petromyzon marinus (sea lamprey) pma-miR-103b-3p
    44. Pongo pygmaeus (Bornean orangutan) ppy-miR-103
    45. Pteropus alecto pal-miR-103b-3p
    46. Pundamilia nyererei pny-miR-103
    47. Python bivittatus (Burmese python) pbv-miR-103-3p
    48. Rattus norvegicus rno-miR-103-3p
    49. Salmo salar (Atlantic salmon) ssa-miR-103-3p
    50. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-103-P2_3p (mature (guide))
    51. Scyliorhinus torazame (cloudy catshark) Sto-Mir-103-P2_3p (mature (guide))
    52. Sus scrofa ssc-miR-103
    53. Taeniopygia guttata tgu-miR-103-3p
    54. Takifugu rubripes (torafugu) fru-miR-107
    55. Tetraodon nigroviridis tni-miR-103
    56. Tor tambroides miR-103
    57. Tupaia chinensis (Chinese tree shrew) tch-miR-103a-3p
    58. Xenopus laevis xla-miR-103a-3p
    59. Xenopus tropicalis xtr-miR-103