Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-103-3p URS0000476BE1_9031

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Gallus gallus. Annotated by 5 databases (PirBase, RefSeq, miRBase, ENA, MirGeneDB). Gallus gallus (chicken) gga-miR-103-3p sequence is a product of MIR103A1, gga-miR-103, miR-103, gga-miR-103-3p, miR-103-3p, MIR103A2 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCAGCAUUGUACAGGGCUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 65 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-103-P2_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-103-P2_3p (mature (guide))
    3. Ateles geoffroyi age-miR-103
    4. Bos taurus (cattle) bta-miR-103
    5. Callorhinchus milii Cmi-Mir-103-P2_3p (mature (guide))
    6. Canis lupus familiaris (dog) cfa-miR-103
    7. Capra hircus (goat) chi-miR-103-3p
    8. Cavia porcellus cpo-miR-103-3p
    9. Cervus elaphus cel-miR-103
    10. Chiloscyllium plagiosum microRNA cpl-miR-103
    11. Chrysemys picta bellii Cpi-Mir-103-P2_3p (mature (guide))
    12. Columba livia cli-miR-103-3p
    13. Cricetulus griseus cgr-miR-103-3p
    14. Cyprinus carpio ccr-miR-103
    15. Danio rerio (zebrafish) dre-miR-103
    16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-103a-3p
    17. Echinops telfairi Ete-Mir-103-P2_3p (mature (guide))
    18. Equus caballus eca-miR-107a
    19. Gadus morhua (Atlantic cod) gmo-miR-103-3p
    20. Gekko japonicus Gja-Mir-103-P2_3p (mature (guide))
    21. Gorilla gorilla (western gorilla) ggo-miR-103
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-103
    23. Homo sapiens hsa-miR-103a-3p
    24. Ictalurus punctatus (channel catfish) ipu-miR-103
    25. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-103
    26. Lagothrix lagotricha lla-miR-103
    27. Latimeria chalumnae Lch-Mir-103-P2_3p (mature (guide))
    28. Lepisosteus oculatus Loc-Mir-103-P2_3p (mature (guide))
    29. Macaca mulatta (Rhesus monkey) mml-miR-103-3p
    30. Macaca nemestrina mne-miR-103
    31. Maylandia zebra mze-miR-103
    32. Microcaecilia unicolor Mun-Mir-103-P2_3p (mature (guide))
    33. Microcebus murinus mmr-miR-103b
    34. Monodelphis domestica mdo-miR-103-3p
    35. Monopterus albus (swamp eel) Mal-Mir-103-P2b_3p (mature (guide))
    36. Mus musculus mmu-miR-103-3p
    37. Neolamprologus brichardi nbr-miR-103
    38. Nomascus leucogenys nle-miR-103a
    39. Ophiophagus hannah (king cobra) oha-miR-103a-3p
    40. Oreochromis niloticus oni-miR-103
    41. Ornithorhynchus anatinus (platypus) oan-miR-103-3p
    42. Oryctolagus cuniculus ocu-miR-103a-3p
    43. Otolemur garnettii (small-eared galago) oga-miR-103a
    44. Ovis aries (sheep) miscellaneous RNA
    45. Pan paniscus (pygmy chimpanzee) ppa-miR-103
    46. Pan troglodytes (chimpanzee) ptr-miR-103
    47. Papio hamadryas pha-miR-103a
    48. Petromyzon marinus pma-miR-103b-3p
    49. Pongo pygmaeus ppy-miR-103
    50. Pteropus alecto pal-miR-103b-3p
    51. Pundamilia nyererei pny-miR-103
    52. Python bivittatus pbv-miR-103-3p
    53. Rattus norvegicus rno-miR-103-3p
    54. Salmo salar ssa-miR-103-3p
    55. Sarcophilus harrisii Sha-Mir-103-P2_3p (mature (guide))
    56. Scyliorhinus torazame (cloudy catshark) Sto-Mir-103-P2_3p (mature (guide))
    57. Sphenodon punctatus (tuatara) Spt-Mir-103-P2_3p (mature (guide))
    58. Sus scrofa (pig) ssc-miR-103
    59. Taeniopygia guttata tgu-miR-103-3p
    60. Takifugu rubripes fru-miR-103
    61. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-103
    62. Tor tambroides (Thai mahseer) miR-103
    63. Tupaia chinensis (Chinese tree shrew) tch-miR-103a-3p
    64. Xenopus laevis (African clawed frog) xla-miR-103a-3p
    65. Xenopus tropicalis xtr-miR-103
    Publications New