Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-103-3p URS0000476BE1_13616

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Monodelphis domestica. Annotated by 4 databases (MirGeneDB, RefSeq, ENA, miRBase). Monodelphis domestica (gray short-tailed opossum) mdo-miR-103-3p sequence is a product of miR-103-3p, MIR103-1, miR-103, mdo-miR-103-3p, MIR103-2, mdo-miR-103 genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCAGCAUUGUACAGGGCUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 65 other species

    1. Alligator mississippiensis Ami-Mir-103-P2_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-103-P2_3p (mature (guide))
    3. Ateles geoffroyi age-miR-103
    4. Bos taurus bta-miR-103
    5. Callorhinchus milii Cmi-Mir-103-P2_3p (mature (guide))
    6. Canis lupus familiaris cfa-miR-103
    7. Capra hircus chi-miR-103-3p
    8. Cavia porcellus (domestic guinea pig) cpo-miR-103-3p
    9. Cervus elaphus (red deer) cel-miR-103
    10. Chiloscyllium plagiosum microRNA cpl-miR-103
    11. Chrysemys picta bellii Cpi-Mir-103-P2_3p (mature (guide))
    12. Columba livia cli-miR-103-3p
    13. Cricetulus griseus cgr-miR-103-3p
    14. Cyprinus carpio (common carp) ccr-miR-103
    15. Danio rerio dre-miR-103
    16. Dasypus novemcinctus dno-miR-103a-3p
    17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-103-P2_3p (mature (guide))
    18. Equus caballus (horse) eca-miR-107a
    19. Gadus morhua gmo-miR-103-3p
    20. Gallus gallus gga-miR-103-3p
    21. Gekko japonicus Gja-Mir-103-P2_3p (mature (guide))
    22. Gorilla gorilla ggo-miR-103
    23. Haplochromis burtoni abu-miR-103
    24. Homo sapiens (human) hsa-miR-103a-3p
    25. Ictalurus punctatus ipu-miR-103
    26. Ictidomys tridecemlineatus microRNA miR-103
    27. Lagothrix lagotricha lla-miR-103
    28. Latimeria chalumnae (coelacanth) Lch-Mir-103-P2_3p (mature (guide))
    29. Lepisosteus oculatus (spotted gar) Loc-Mir-103-P2_3p (mature (guide))
    30. Macaca mulatta (Rhesus monkey) mml-miR-103-3p
    31. Macaca nemestrina (pig-tailed macaque) mne-miR-103
    32. Maylandia zebra mze-miR-103
    33. Microcaecilia unicolor Mun-Mir-103-P2_3p (mature (guide))
    34. Microcebus murinus (gray mouse lemur) mmr-miR-103a
    35. Monopterus albus Mal-Mir-103-P2b_3p (mature (guide))
    36. Mus musculus (house mouse) mmu-miR-103-3p
    37. Neolamprologus brichardi nbr-miR-103
    38. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-103a
    39. Ophiophagus hannah (king cobra) oha-miR-103a-3p
    40. Oreochromis niloticus (Nile tilapia) oni-miR-103
    41. Ornithorhynchus anatinus oan-miR-103-3p
    42. Oryctolagus cuniculus ocu-miR-103a-3p
    43. Otolemur garnettii (small-eared galago) oga-miR-103a
    44. Ovis aries (sheep) miscellaneous RNA
    45. Pan paniscus ppa-miR-103
    46. Pan troglodytes ptr-miR-103
    47. Papio hamadryas pha-miR-103a
    48. Petromyzon marinus pma-miR-103b-3p
    49. Pongo pygmaeus (Bornean orangutan) ppy-miR-103
    50. Pteropus alecto pal-miR-103b-3p
    51. Pundamilia nyererei pny-miR-103
    52. Python bivittatus pbv-miR-103-3p
    53. Rattus norvegicus (Norway rat) rno-miR-103-3p
    54. Salmo salar (Atlantic salmon) ssa-miR-103-3p
    55. Sarcophilus harrisii Sha-Mir-103-P2_3p (mature (guide))
    56. Scyliorhinus torazame (cloudy catshark) Sto-Mir-103-P2_3p (mature (guide))
    57. Sphenodon punctatus Spt-Mir-103-P2_3p (mature (guide))
    58. Sus scrofa (pig) ssc-miR-103
    59. Taeniopygia guttata tgu-miR-103-3p
    60. Takifugu rubripes fru-miR-103
    61. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-103
    62. Tor tambroides miR-103
    63. Tupaia chinensis (Chinese tree shrew) tch-miR-103a-3p
    64. Xenopus laevis (African clawed frog) xla-miR-103a-3p
    65. Xenopus tropicalis xtr-miR-103
    Publications New