Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-103-3p URS0000476BE1_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 8 databases (PirBase, LncBase, ENA, miRBase, RefSeq, TarBase, PSICQUIC, MirGeneDB). Described in 35 papers. Mus musculus (house mouse) mmu-miR-103-3p sequence is a product of mmu-miR-103-3p, mmu-miR-103, miR-103-3p, Mir103-2, miR-103, Mir103-1 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610008P16Rik, 0610009B22Rik, 0610011A13Rik, 0610011H21Rik, 0610011L04Rik, 0610030G24Rik, 0610040J01Rik, 0610041L09Rik, 0710008J23Rik, 107kDa.

Interactions 8

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-103-3p interacts with:

Interaction id Participant Synonyms
URS0000476BE1_10090-0 P04918 P04918
URS0000476BE1_10090-1 P11152 P11152
URS0000476BE1_10090-3 P49817 P49817
URS0000476BE1_10090-7 P49817 P49817
URS0000476BE1_10090-2 P49817 P49817
URS0000476BE1_10090-6 P49817 P49817
URS0000476BE1_10090-4 Q60963 Q60963
URS0000476BE1_10090-5 Q99P91 Q99P91

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCAGCAUUGUACAGGGCUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 117 other species

    1. Alligator mississippiensis Ami-Mir-103-P1_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-103-P2_3p (mature (guide))
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-103
    4. Bos taurus (cattle) bta-miR-103
    5. Callorhinchus milii (elephant shark) eshark_mir-103_2
    6. Canis lupus familiaris (dog) cfa-miR-103
    7. Capra hircus chi-miR-103-3p
    8. Cavia porcellus cpo-miR-103-3p
    9. Cervus elaphus (red deer) cel-miR-103
    10. Chiloscyllium plagiosum microRNA cpl-miR-103
    11. Chrysemys picta bellii Cpi-Mir-103-P2_3p (mature (guide))
    12. Columba livia cli-miR-103-3p
    13. Cricetulus griseus (Chinese hamster) cgr-miR-103-3p
    14. Cyprinus carpio (common carp) ccr-miR-103
    15. Danio rerio dre-miR-103
    16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-103a-3p
    17. Echinops telfairi Ete-Mir-103-P2_3p (mature (guide))
    18. Equus caballus eca-miR-103
    19. Gadus morhua (Atlantic cod) gmo-miR-103-3p
    20. Gallus gallus (chicken) gga-miR-103-3p
    21. Gorilla gorilla (western gorilla) ggo-miR-103
    22. Haplochromis burtoni abu-miR-103
    23. Homo sapiens (human) hsa-miR-103a-3p
    24. Ictalurus punctatus ipu-miR-103
    25. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-103
    26. Lagothrix lagotricha (brown woolly monkey) lla-miR-103
    27. Macaca mulatta mml-miR-103-3p
    28. Macaca nemestrina mne-miR-103
    29. Maylandia zebra (zebra mbuna) mze-miR-103
    30. Microcebus murinus (gray mouse lemur) mmr-miR-103b
    31. Monodelphis domestica (gray short-tailed opossum) mdo-miR-103-3p
    32. Neolamprologus brichardi nbr-miR-103
    33. Nomascus leucogenys nle-miR-103a
    34. Ophiophagus hannah oha-miR-103a-3p
    35. Oreochromis niloticus (Nile tilapia) oni-miR-103
    36. Ornithorhynchus anatinus oan-miR-103-3p
    37. Oryctolagus cuniculus ocu-miR-103a-3p
    38. Otolemur garnettii oga-miR-103a
    39. Ovis aries (sheep) miscellaneous RNA
    40. Pan paniscus ppa-miR-103
    41. Pan troglodytes (chimpanzee) ptr-miR-103
    42. Papio hamadryas pha-miR-103b
    43. Petromyzon marinus (sea lamprey) pma-miR-103b-3p
    44. Pongo pygmaeus ppy-miR-103
    45. Pteropus alecto (black flying fox) pal-miR-103b-3p
    46. Pundamilia nyererei pny-miR-103
    47. Python bivittatus pbv-miR-103-3p
    48. Rattus norvegicus rno-miR-103-3p
    49. Salmo salar ssa-miR-103-3p
    50. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-103-P2_3p (mature (guide))
    51. Scyliorhinus torazame (cloudy catshark) Sto-Mir-103-P2_3p (mature (guide))
    52. Sus scrofa ssc-miR-103
    53. Taeniopygia guttata (zebra finch) tgu-miR-103-3p
    54. Takifugu rubripes fru-miR-107
    55. Tetraodon nigroviridis tni-miR-103
    56. Tor tambroides miR-103
    57. Tupaia chinensis (Chinese tree shrew) tch-miR-103a-3p
    58. Xenopus laevis xla-miR-103a-3p
    59. Xenopus tropicalis xtr-miR-103