Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-492 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-492 precursor URS0000476A52_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR492: MIR492 is a microRNA that has been studied in various contexts. In a study analyzing breast tumor samples, MIR492 was found to be expressed in both normal and tumor samples [PMC3306365]. In another study, MIR492 was identified as one of the genes present in amplified regions [PMC4767443]. Additionally, MIR492 was found to be inhibited by circular RNA has_circ_0005567, which promoted M2-like differentiation of synovial macrophages and suppressed osteoarthritis progression [PMC9369350]. Network inference analysis revealed that MIR492 is involved in the regulation of multiple microRNAs and has been shown to be protective against ischemia-induced cell death [PMC8833867]. Swimming was found to increase the expression of MIR492 and decrease resistin expression, leading to a delay in the severity of atherosclerosis and insulin resistance [PMC6636482]. In the context of papillary thyroid carcinoma (PTC), MIR492 was highly upregulated in BRAFmut PTCs compared to BRAFwt PTCs [PMC4075542]. Furthermore, overexpression of MIR492 has been linked to progressive hepatoblastoma and tumorigenesis of retinoblastoma [PMC4315163]. Possible targets for MIR492 include KRT19 mRNA and thyroid hormone receptor-associated protein 3 (THRAP3) mRNA, both of which are downregulated in PTCs compared to normal thyroid samples [PMC4315163]. The regulation and function of MIR492 in insulin resistance are not well understood [PMC4006129].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAACUACAGCCACUACUACAGGACCAUCGAGGACCUGCGGGACAAGAUUCUUGGUGCCACCAUUGAGAACGCCAGGAUUGUCCUGCAGAUCAACAAUGCUCAACUGGCUGCAGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications