Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR1846d-5p URS00004754D8_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR1846d-5p: Osa-mir1846d-5p is one of the miRNAs that have no predicted target genes, along with osa-miR166j-5p [PMC8551726]. Several heat-responsive miRNAs, including osa-mir1846d-5p, have been identified to target heat shock factors (HSFs) and heat shock proteins (HSPs) to regulate gene expression [PMC9136941]. In the P+H+ condition, the expression of osa-mir1846d-5p is higher compared to P-H+ condition [PMC8067039]. Under priming conditions (P+H-), the expression patterns of osa-mir1846d-5p and other miRNAs such as osa-miR5149, osa-miR5077, osa-miR168a-5p, and osa-miR167e are inversely correlated with the expression of their respective targets [PMC8067039]. These targets include key HSFs and HSPs that are regulated by miRNAs such as osa-mir1846d-5p [PMC8067039]. Osa-mir1846d-5p and other identified miRNAs play a specific role in altering gene expression in response to heat priming [PMC8067039]. The changes in levels of osa-mir1846d-5p and other miRNAs under priming conditions are inversely correlated with changes in their respective transcripts [PMC8067039]. In summary, Osa-mir1846d-5p is a specific type of miRNA that has no predicted target genes. It is involved in regulating gene expression by targeting HSFs and HSPs under heat-responsive conditions. The expression patterns of Osa-mir1846d-5p and other miRNAs are inversely correlated with the expression of their respective targets, and their levels change in response to heat priming. [PMC8551726] [PMC9136941] [PMC8067039].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCACCGAGCAGCCGGAUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group microRNA osa-miR1846d-5p
Publications