Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-32 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-32 precursor URS0000472EB8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR32: MIR32 is a microRNA that has been found to be upregulated in thyroid cancer compared to benign thyroid tumors in a microarray study [PMC4315163]. However, the functional implications of MIR32 in papillary thyroid carcinoma (PTC) are still unknown [PMC4315163]. Studies have shown that MIR32 can directly inhibit the RNA virus primate foamy retrovirus type 1, which is comparable to HIV1, at the protein level [PMC7833564]. Additionally, MIR32 has been found to have a supplementary degradative function in the coding region for influenza PB1 [PMC7833564]. In the context of Tmprss2 as a critical drug target, it has been suggested that MIR32 could be employed as a potential therapeutic for specific suppression of Tmprss2 [PMC7833564]. Differential gene analysis identified MIR32 as one of the top 40 differential genes in thyroid cancer [PMC9730279]. In experimental studies, MIR32 mimics and antagomirs were transfected into 293 T cells to investigate their effects on PIKfyve-3' UTR Wt and PIKfyve-3' UTR Mut expression levels [PMC6967090]. Real-time PCR assays were used to assess the expression levels of various miRNAs including MIR32 in different experimental conditions [PMC3424561] and it was found that miRNAs such as miR140, miR141, and miR184 showed decreased abundance while miRNAs such as miR150 and miR146 showed increased abundance in knockout mice compared to wild-type mice [PMC10001410].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Aotus nancymaae microRNA 32 (ENSANAG00000005600.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) mir-32 microRNA precursor family
  3. Carlito syrichta (Philippine tarsier) microRNA 32 (ENSTSYG00000029925.1)
  4. Cebus imitator microRNA 32 (ENSCCAG00000007494.1)
  5. Cercocebus atys (Sooty mangabey) microRNA 32 (ENSCATG00000010970.1)
  6. Chlorocebus sabaeus (African green monkey) microRNA 32 (ENSCSAG00000020087.1)
  7. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000009932.1)
  8. Dipodomys ordii microRNA 32 (ENSDORG00000020032.2)
  9. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000003592.1)
  10. Gorilla gorilla gorilla ggo-mir-32 (ENSGGOG00000038840.1, ENSGGOG00000042369.1)
  11. Gorilla gorilla microRNA ggo-mir-32 precursor
  12. Heterocephalus glaber mir-32 microRNA precursor family
  13. Ictidomys tridecemlineatus microRNA 32 (ENSSTOG00000016680.1)
  14. Macaca mulatta microRNA mml-mir-32 precursor
  15. Macaca nemestrina microRNA mne-mir-32 precursor
  16. Mandrillus leucophaeus (Drill) microRNA 32 (ENSMLEG00000002385.1)
  17. Marmota monax (woodchuck) non-coding RNA
  18. Meriones unguiculatus (Mongolian gerbil) miRNA (ENSMUGG00000011747.1)
  19. Microcebus murinus (gray mouse lemur) microRNA 32 (ENSMICG00000019634.3)
  20. Mus caroli microRNA 32 (MGP_CAROLIEiJ_G0007871.1)
  21. Mus musculus microRNA mmu-mir-32 precursor
  22. Mus pahari microRNA 32 (MGP_PahariEiJ_G0007535.1)
  23. Mus spretus microRNA 32 (MGP_SPRETEiJ_G0008266.1)
  24. Nannospalax galili microRNA 32 (ENSNGAG00000006321.1)
  25. Neotoma lepida (desert woodrat) mir-32 microRNA precursor family
  26. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 32 (ENSNLEG00000022293.2)
  27. Ochotona princeps (American pika) microRNA 32 (ENSOPRG00000017595.1, ENSOPRG00000018500.1)
  28. Octodon degus microRNA 32 (ENSODEG00000022003.1)
  29. Oryctolagus cuniculus mir-32 microRNA precursor family
  30. Otolemur garnettii (small-eared galago) microRNA 32 (ENSOGAG00000017508.1)
  31. Pan paniscus microRNA ppa-mir-32 precursor
  32. Pan troglodytes microRNA ptr-mir-32 precursor
  33. Papio anubis mir-32 microRNA precursor family
  34. Peromyscus maniculatus bairdii microRNA 32 (ENSPEMG00000001812.2)
  35. Pongo abelii mir-32 microRNA precursor family
  36. Pongo pygmaeus microRNA ppy-mir-32 precursor
  37. Rhinopithecus bieti microRNA 32 (ENSRBIG00000009683.1)
  38. Rhinopithecus roxellana microRNA 32 (ENSRROG00000018526.1)
  39. Saguinus labiatus microRNA sla-mir-32 precursor
  40. Saimiri boliviensis boliviensis microRNA 32 (ENSSBOG00000000932.1)
  41. Tupaia chinensis mir-32 microRNA precursor family
2D structure Publications