Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-32 precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-32 precursor URS0000472EB8_10090

Automated summary: This pre miRNA sequence is 70 nucleotides long and is found in Mus musculus. Annotated by 7 databases (miRBase, Ensembl, RefSeq, Rfam, ENA, MGI, Ensembl/GENCODE). Described in 23 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-32, RF00666). Mus musculus (house mouse) microRNA mmu-mir-32 precursor sequence is a product of ENSMUSG00000065544.2, mir-32, 32, Mir32, mir-32 precursor, mir-32 precurso, mmu-mir-32 precursor genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 72 other species

    1. Aotus nancymaae miRNA (ENSANAG00000005600.1)
    2. Callithrix jacchus microRNA mir-32
    3. Carlito syrichta miRNA (ENSTSYG00000029925.1)
    4. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000010970.1)
    5. Chlorocebus sabaeus miRNA (ENSCSAG00000020087.1)
    6. Colobus angolensis palliatus microRNA 32 (ENSCANG00000009932.1)
    7. Dipodomys ordii microRNA 32 (ENSDORG00000020032.2)
    8. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000003592.1)
    9. Gorilla gorilla gorilla ggo-mir-32 (ENSGGOG00000038840.1, ENSGGOG00000042369.1)
    10. Gorilla gorilla (western gorilla) microRNA ggo-mir-32 precursor
    11. Heterocephalus glaber microRNA 32 (ENSHGLG00000022362.1, ENSHGLG00100023356.1)
    12. Homo sapiens (human) microRNA hsa-mir-32 precursor
    13. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 32 (ENSSTOG00000016680.1)
    14. Macaca fascicularis (Crab-eating macaque) miRNA
    15. Macaca mulatta microRNA mml-mir-32 precursor
    16. Macaca nemestrina microRNA mne-mir-32 precursor
    17. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000002385.1)
    18. Marmota monax non-coding RNA
    19. Meriones unguiculatus (Mongolian gerbil) miRNA (ENSMUGG00000011747.1)
    20. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000019634.3)
    21. Mus caroli (Ryukyu mouse) microRNA 32 (MGP_CAROLIEiJ_G0007871.1)
    22. Mus pahari (Shrew mouse) microRNA 32 (MGP_PahariEiJ_G0007535.1)
    23. Mus spretus microRNA 32 (MGP_SPRETEiJ_G0008266.1)
    24. Nannospalax galili microRNA 32 (ENSNGAG00000006321.1)
    25. Neotoma lepida microRNA mir-32
    26. Nomascus leucogenys miRNA (ENSNLEG00000022293.2)
    27. Ochotona princeps miRNA (ENSOPRG00000017595.1, ENSOPRG00000018500.1)
    28. Octodon degus (Degu) microRNA 32 (ENSODEG00000022003.1)
    29. Oryctolagus cuniculus microRNA mir-32
    30. Otolemur garnettii miRNA (ENSOGAG00000017508.1)
    31. Pan paniscus microRNA ppa-mir-32 precursor
    32. Pan troglodytes microRNA ptr-mir-32 precursor
    33. Papio anubis miRNA (ENSPANG00000002706.2)
    34. Peromyscus maniculatus bairdii microRNA 32 (ENSPEMG00000001812.2)
    35. Pongo abelii microRNA 32 (ENSPPYG00000022189.1)
    36. Pongo pygmaeus microRNA ppy-mir-32 precursor
    37. Rhinopithecus bieti miRNA (ENSRBIG00000009683.1)
    38. Rhinopithecus roxellana microRNA 32 (ENSRROG00000018526.1)
    39. Saguinus labiatus microRNA sla-mir-32 precursor
    40. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000000932.1)
    41. Tupaia chinensis microRNA mir-32
    2D structure New