Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-198 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-198 precursor URS0000471A62_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-198: Hsa-mir-198 is a miRNA that has been studied in various contexts. In a microarray analysis, hsa-mir-198 showed differences in expression between males and females, although it did not reach statistical significance (P = 0.064) [PMC4509933]. Hsa-mir-198 has also been found to interact with circRNAs, such as hsa_circ_0000690 [PMC9344620]. Additionally, hsa-mir-198 has been associated with tumor development and is closely related to different types of tumors [PMC6948356]. One SNP (rs1700) in hsa-mir-198 was not included in GWAS marker sets [PMC2834616]. Hsa-mir-198 is one of the top nodes in a network analysis that includes other miRNAs and circRNAs [PMC10035830]. Furthermore, hsa-mir-198 has been found to have antiviral roles against SARS-CoV and SARS-CoV-2 infections [PMC7381279]. In the context of HIV infection, the level of hsa-mir-198 is upregulated by HIV strains tested in a study [PMC3120759]. Hsa-mir-198 is one of the miRNAs that target the largest number of genes associated with schizophrenia (SZGenes) [PMC2834616]. This may be due to its primate-specific nature and potential for false positive target predictions [PMC2834616]. References: [PMC4509933]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4509933/ [PMC9344620]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9344620/ [PMC6948356]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6948356/ [PMCID: PMC2834616]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2834616/ [PMC10035830]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10035830/ [PMC7381279]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7381279/ [PMC3120759]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3120759/

MIR198: MIR198 is a microRNA that is located in the 3' UTR of the FLST1 gene [PMC4433211]. It has been found to be involved in various biological processes and diseases. For example, during wound healing, there is dynamic competition between protein and miRNA production from the FSTL1 locus, which harbors MIR198 [PMC4079977]. MIR198 has also been shown to repress CycT1 expression in resting monocytes and CD4+ T cells [PMC3705304]. It may be loaded onto EXOmiRNA through binding to EXO-motifs such as GGAG [PMC8806638]. In glioma, TGF-β has been found to decrease MIR198 expression without affecting other miRNAs [PMC9104899]. In prostate cancer tissues and cell lines, the expression of MIR198 is markedly decreased compared to normal paired samples [PMC7844842]. In HCV-induced HCC tissues, there is an increase in the expression of MIR198 compared to adjacent non-tumor tissue [PMC3741284]. Higher levels of MIR198 have also been found in BM-MSC-exosomes from MDS patients compared with healthy donors [PMC7906808]. However, there are conflicting reports on the expression of MIR198 in primary monocytes and its role in HIV-1 infection mechanisms [PMC3697138]. Furthermore, circAKT3 has been shown to promote DNA damage repair and inhibit cell apoptosis through sponging MIR198 [PMC7724307].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAUUGGUCCAGAGGGGAGAUAGGUUCCUGUGAUUUUUCCUUCUUCUCUAUAGAAUAAAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gorilla gorilla gorilla microRNA mir-198 (MIR198)
  2. Gorilla gorilla microRNA ggo-mir-198 precursor
2D structure Publications