Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-128 precursor (hsa-mir-128-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-128 precursor (hsa-mir-128-2) URS000046FA49_9606

  • 84 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 87 species

Automated summary: This pre miRNA sequence is 84 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, Rfam, GeneCards, miRBase, ENA, Ensembl, HGNC, MalaCards, Ensembl/GENCODE). Described in 43 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-128, RF00649). Homo sapiens (human) microRNA hsa-mir-128 precursor (hsa-mir-128-2) sequence is a product of mir-128-2, mir-128-2 precursor, 2, 128, hsa-mir-128-2 precursor, 128-2, MIR128-2, mir-128, ENSG00000207625.1, mir-128-2 precurso genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUGCAGUGGGAAGGGGGGCCGAUACACUGUACGAGAGUGAGUAGCAGGUCUCACAGUGAACCGGUCUCUUUCCCUACUGUGUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 86 other species

    1. Ailuropoda melanoleuca microRNA 128-2 (ENSAMEG00000021894.2)
    2. Callithrix jacchus cja-mir-128-2 (ENSCJAG00000025495.2)
    3. Canis lupus dingo (dingo) microRNA 128-2 (ENSCAFG00020001707.1)
    4. Canis lupus familiaris miRNA (ENSCAFG00000020567.1, ENSCAFG00030004456.1, ENSCAFG00040013086.1)
    5. Cavia porcellus microRNA mir-128
    6. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000015847.1)
    7. Chlorocebus sabaeus miRNA (ENSCSAG00000025340.1)
    8. Choloepus hoffmanni miRNA (ENSCHOG00000014841.1)
    9. Colobus angolensis palliatus miRNA (ENSCANG00000010481.1)
    10. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000028085.1)
    11. Felis catus (domestic cat) miRNA (ENSFCAG00000016611.3)
    12. Fukomys damarensis microRNA mir-128
    13. Gorilla gorilla gorilla microRNA 128-2 (ENSGGOG00000032793.2)
    14. Lynx canadensis microRNA 128-2 (ENSLCNG00005021921.1)
    15. Macaca fascicularis miRNA (ENSMFAG00000006476.2)
    16. Macaca mulatta microRNA mml-mir-128b precursor
    17. Macaca nemestrina miRNA (ENSMNEG00000000220.1)
    18. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000024616.1)
    19. Marmota marmota marmota (Alpine marmot) microRNA 128-2 (ENSMMMG00000012337.1)
    20. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000018090.3)
    21. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000021620.1)
    22. Neovison vison miRNA (ENSNVIG00000008065.1)
    23. Nomascus leucogenys miRNA (ENSNLEG00000021624.2)
    24. Oryctolagus cuniculus microRNA 128-2 (ENSOCUG00000018015.1)
    25. Otolemur garnettii miRNA (ENSOGAG00000017377.1)
    26. Pan paniscus miRNA (ENSPPAG00000001331.1)
    27. Panthera leo microRNA 128-2 (ENSPLOG00000007191.1)
    28. Panthera pardus microRNA 128-2 (ENSPPRG00000014320.1)
    29. Pan troglodytes ptr-mir-128-2 (ENSPTRG00000027809.2)
    30. Papio anubis miRNA (ENSPANG00000026931.2)
    31. Piliocolobus tephrosceles miRNA (ENSPTEG00000012662.1)
    32. Pongo abelii microRNA 128-2 (ENSPPYG00000021091.1)
    33. Pongo pygmaeus microRNA ppy-mir-128 precursor (ppy-mir-128-2)
    34. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000010733.1)
    35. Propithecus coquereli miRNA (ENSPCOG00000010549.1)
    36. Rhinopithecus bieti miRNA (ENSRBIG00000020395.1)
    37. Rhinopithecus roxellana miRNA (ENSRROG00000027281.1)
    38. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000006506.1)
    39. Sciurus vulgaris (Eurasian red squirrel) miRNA (ENSSVLG00005015619.1)
    40. Ictidomys tridecemlineatus microRNA mir-128
    41. Suricata suricatta (meerkat) microRNA 128-2 (ENSSSUG00005004555.1)
    42. Theropithecus gelada microRNA 128-2 (ENSTGEG00000022656.1)
    43. Tupaia belangeri miRNA (ENSTBEG00000017889.1)
    44. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010005047.1)
    45. Ursus americanus miRNA (ENSUAMG00000018546.1)
    46. Ursus thibetanus thibetanus microRNA 128-2 (ENSUTTG00000002257.1)
    47. Vulpes vulpes miRNA (ENSVVUG00000022012.1)
    2D structure New