Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-128 precursor (hsa-mir-128-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-128 precursor (hsa-mir-128-2) URS000046FA49_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR128-2: MIR128-2 is a miRNA that has been found to be recurrently aberrant in expression in various studies [PMC3566410]. Mutant TP53 has been shown to bind to the putative promoter of the MIR128-2 host gene ARPP21, leading to increased expression of both miR-128 and ARPP21 mRNA [PMC4302087]. A mutation in the MIR128-2 gene, specifically the A13G mutation, has been found to reduce the processing of pri-miR-128-2 and result in glucocorticoid resistance in t(4;11) ALL cells [PMC9406077]. Additionally, mutp53 R175H has been shown to induce the expression of MIR128-2, which targets E2F5 and confers resistance to various cancer treatments [PMC7749743]. MIR128-1 and MIR128-2 are members of the miRNA MIR128 family and encode the same mature miR-128, which plays different roles in tumorigenesis depending on cancer type [PMC7802300]. A three-miRNA signature called miGISig, which includes MIR421, MIR128-1, and MIR128-2, has been identified as predictive of gastrointestinal (GI) cancer and clinical outcome [PMC7802300]. Dysregulation of both MIR128-1 and MIR128-2 has also been observed in glioblastomas [PMC3821381]. The genes encoding miR-128 transcripts are located on different chromosomes (MIR128 family on chromosome 3p22; ARPP21 gene on chromosome 3p22) but encode identical mature sequences with slight differences in their 5p species [PMC5481840].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAGUGGGAAGGGGGGCCGAUACACUGUACGAGAGUGAGUAGCAGGUCUCACAGUGAACCGGUCUCUUUCCCUACUGUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 47 other species

  1. Ailuropoda melanoleuca (giant panda) microRNA 128-2 (ENSAMEG00000021894.2)
  2. Callithrix jacchus cja-mir-128-2 (ENSCJAG00000025495.3)
  3. Canis lupus dingo microRNA 128-2 (ENSCAFG00020001707.1)
  4. Canis lupus familiaris miRNA (ENSCAFG00000020567.2, ENSCAFG00030004456.1, ENSCAFG00040013086.1, ENSCAFG00845025627.1)
  5. Cebus imitator microRNA 128-2 (ENSCCAG00000005540.1)
  6. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000015847.1)
  7. Chlorocebus sabaeus (African green monkey) microRNA 128-2 (ENSCSAG00000025340.1)
  8. Choloepus hoffmanni miRNA (ENSCHOG00000014841.1)
  9. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000010481.1)
  10. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000028085.1)
  11. Felis catus (domestic cat) microRNA 128-2 (ENSFCAG00000016611.3)
  12. Gorilla gorilla gorilla microRNA 128-2 (ENSGGOG00000032793.2)
  13. Heterocephalus glaber microRNA 128-2 (ENSHGLG00000022618.2)
  14. Lynx canadensis microRNA 128-2 (ENSLCNG00005021921.1)
  15. Macaca fascicularis (Crab-eating macaque) microRNA 128-2 (ENSMFAG00000006476.2)
  16. Macaca mulatta (Rhesus monkey) microRNA mml-mir-128b precursor
  17. Macaca nemestrina miRNA (ENSMNEG00000000220.1)
  18. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000024616.1)
  19. Marmota marmota marmota microRNA 128-2 (ENSMMMG00000012337.1)
  20. Microcebus murinus (gray mouse lemur) microRNA 128-2 (ENSMICG00000018090.3)
  21. Mustela putorius furo miRNA (ENSMPUG00000021620.1)
  22. Neogale vison miRNA (ENSNVIG00000008065.1)
  23. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 128-2 (ENSNLEG00000021624.2)
  24. Oryctolagus cuniculus (rabbit) microRNA 128-2 (ENSOCUG00000018015.1)
  25. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017377.1)
  26. Pan paniscus (bonobo) microRNA 128-2 (ENSPPAG00000001331.1)
  27. Panthera leo microRNA 128-2 (ENSPLOG00000007191.1)
  28. Panthera pardus (leopard) microRNA 128-2 (ENSPPRG00000014320.1)
  29. Pan troglodytes ptr-mir-128-2 (ENSPTRG00000027809.2)
  30. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000012662.1)
  31. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000021091.2)
  32. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-128 precursor (ppy-mir-128-2)
  33. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000010733.1)
  34. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000010549.1)
  35. Rhinopithecus bieti miRNA (ENSRBIG00000020395.1)
  36. Rhinopithecus roxellana miRNA (ENSRROG00000027281.1)
  37. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000006506.1)
  38. Sciurus vulgaris (Eurasian red squirrel) microRNA 128-2 (ENSSVLG00005015619.1)
  39. Suricata suricatta (meerkat) microRNA 128-2 (ENSSSUG00005004555.1)
  40. Theropithecus gelada microRNA 128-2 (ENSTGEG00000022656.1)
  41. Tupaia belangeri miRNA (ENSTBEG00000017889.1)
  42. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010005047.1)
  43. Ursus americanus (American black bear) miRNA (ENSUAMG00000018546.1)
  44. Ursus thibetanus thibetanus microRNA 128-2 (ENSUTTG00000002257.1)
  45. Vulpes vulpes (red fox) miRNA (ENSVVUG00000022012.1)
2D structure Publications