Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-216b-5p URS000046CDA6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-216b: Hsa-mir-216b is a mature microRNA that has been studied in various contexts. In one study, hsa-mir-216b mimics and inhibitors were transfected into A549 and PC9 cells, and its interactions with differentially expressed genes (DEGs) were analyzed [PMC5732799]. The study found that hsa-mir-216b targeted 30 DEGs, suggesting its potential importance in ccRCC [PMC6580006]. Another study identified hsa-mir-216b as one of the common target microRNAs in a different context [PMC8831246]. Additionally, the expression of hsa-mir-216b was found to be prominently high in EC tissues [PMC8806668]. The interaction shaped by hsa-mir-216b also led to the suggestion that other unknown microRNAs, such as hsa-miR-3064-3p and hsa-miR-32-3p, may have important roles in breast cancer treatment [PMC5628841]. These findings highlight the potential significance of hsa-mir-216b in various biological processes and disease contexts.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAUCUCUGCAGGCAAAUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

Publications