Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-216b URS000046CDA6_9796

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Equus caballus. Annotated by 2 databases (miRBase, RefSeq). Described in 3 papers. Equus caballus (horse) eca-miR-216b sequence is a product of eca-miR-216b, miR-216b, MIR216B, miR-216 genes. Found in the horse reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAAUCUCUGCAGGCAAAUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Anolis carolinensis aca-miR-216b-5p
    2. Bos taurus (cattle) bta-miR-216b
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-216b
    4. Canis lupus familiaris (dog) cfa-miR-216b
    5. Cavia porcellus cpo-miR-216b-5p
    6. Chrysemys picta bellii Cpi-Mir-216-P1b_5p (mature (guide))
    7. Columba livia cli-miR-216b-5p
    8. Cricetulus griseus (Chinese hamster) cgr-miR-216b
    9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-216b-5p
    10. Echinops telfairi Ete-Mir-216-P1b_5p (mature (co-guide))
    11. Gallus gallus (chicken) gga-miR-216b
    12. Homo sapiens (human) hsa-miR-216b-5p
    13. Macaca mulatta mml-miR-216b
    14. Mus musculus mmu-miR-216b-5p
    15. Pan troglodytes (chimpanzee) ptr-miR-216b
    16. Pongo pygmaeus ppy-miR-216b
    17. Pteropus alecto (black flying fox) pal-miR-216b-5p
    18. Python bivittatus pbv-miR-216b-5p
    19. Rattus norvegicus rno-miR-216b-5p