Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-216b URS000046CDA6_9598

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Pan troglodytes. Annotated by 2 databases (miRBase, RefSeq). Described in 3 papers. Pan troglodytes (chimpanzee) ptr-miR-216b sequence is a product of miR-216, ptr-miR-216b, miR-216b, MIR216B genes. Found in the chimpanzee reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAAUCUCUGCAGGCAAAUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Anolis carolinensis aca-miR-216b-5p
    2. Bos taurus (cattle) bta-miR-216b
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-216b
    4. Canis lupus familiaris (dog) cfa-miR-216b
    5. Cavia porcellus cpo-miR-216b-5p
    6. Chrysemys picta bellii Cpi-Mir-216-P1b_5p (mature (guide))
    7. Columba livia cli-miR-216b-5p
    8. Cricetulus griseus (Chinese hamster) cgr-miR-216b
    9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-216b-5p
    10. Echinops telfairi Ete-Mir-216-P1b_5p (mature (co-guide))
    11. Equus caballus eca-miR-216b
    12. Gallus gallus (chicken) gga-miR-216b
    13. Homo sapiens (human) hsa-miR-216b-5p
    14. Macaca mulatta mml-miR-216b
    15. Mus musculus mmu-miR-216b-5p
    16. Pongo pygmaeus ppy-miR-216b
    17. Pteropus alecto (black flying fox) pal-miR-216b-5p
    18. Python bivittatus pbv-miR-216b-5p
    19. Rattus norvegicus rno-miR-216b-5p