Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysemys picta bellii (western painted turtle) Cpi-Mir-216-P1b_5p (mature (guide)) URS000046CDA6_8478

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Chrysemys picta bellii. Annotated by 1 database (MirGeneDB). Described in 1 paper. Found in the western painted turtle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAAUCUCUGCAGGCAAAUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Anolis carolinensis aca-miR-216b-5p
    2. Bos taurus bta-miR-216b
    3. Callithrix jacchus cja-miR-216b
    4. Canis lupus familiaris cfa-miR-216b
    5. Cavia porcellus cpo-miR-216b-5p
    6. Columba livia cli-miR-216b-5p
    7. Cricetulus griseus cgr-miR-216b
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-216b-5p
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-216-P1b_5p (mature (co-guide))
    10. Equus caballus eca-miR-216b
    11. Gallus gallus (chicken) gga-miR-216b
    12. Homo sapiens hsa-miR-216b-5p
    13. Macaca mulatta mml-miR-216b
    14. Mus musculus mmu-miR-216b-5p
    15. Pan troglodytes ptr-miR-216b
    16. Pongo pygmaeus (Bornean orangutan) ppy-miR-216b
    17. Pteropus alecto pal-miR-216b-5p
    18. Python bivittatus (Burmese python) pbv-miR-216b-5p
    19. Rattus norvegicus rno-miR-216b-5p