v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 881 (LINC00881) URS0000469D72_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00881: LINC00881 is a long intergenic nonprotein coding RNA (lncRNA) that is hypermethylated and downregulated in the failing human heart. It is a cardiac-specific super-enhancer lncRNA that plays a crucial role in regulating calcium handling in cardiomyocytes [PMC9977498]. In vitro studies using human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) have shown that LINC00881 is an essential regulator of cardiomyocyte calcium cycling and an upstream transcriptional regulator of key calcium channel and sarcomere organization genes [PMC9977498]. It interacts with SMARCA4, a chromatin remodeling protein, and regulates the expression of genes involved in transcription, apoptotic process, sarcomere organization, calcium ion transport, ventricular tissue morphogenesis, and fatty acid β-oxidation pathways [PMC9977498]. LINC00881 expression is upregulated during the differentiation of hiPSC-CMs and its dysregulation has been observed in patients with ischemic cardiomyopathy (ICM) and non-ischemic cardiomyopathy (NICM) [PMC9977498]. The regulation of LINC00881 expression involves epigenetic modifications such as DNA methylation and chromatin remodeling [PMC9977498]. The role of LINC00881 as an essential regulator of cardiomyocyte calcium cycling suggests its potential as a therapeutic target for heart failure [PMC9977498].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAAAGUGCUAGGCACGUAGGCGUUCAGGAGACAGUCACGGUACUCGUUUCCAGACAGAAGUCAUGAGGAACAAGAGGGAAGGUGCUUUCCCGUGUGCAGCGCUUGGGGAGACUCACACAGACAGAGGAUCUGGCAUGACAGGGAAAGGAGGAAAUGGCUUCUGUUAAUCUCUCCUUCAGCUUCUCCCGCCCUUCCCAUGCACUCUUCCUGUUUCCCUUUCCAGUUCUCACGGUGACUCAAGGAACAACGUGUGAAAUGAAAGACCUCAGGUGCUGUAUUGGCUCUUGACAGCUCUUCAGAAGAAAAUACCUCCUGCCUGUUCUGUUCAGUCCUGGUGCAGGUGGUCCUGGACAACACUUUGAAAAAUGCUGGGGCAGAAACAAGCCAGCAAGCAUAUGGGAUUCAUCUGCUGUGAGUGAUAAUUUAUCUAGUUUCUAAAAAUAGUGUUAUAGGCUGGACUGUGUCCCCUUCCUGUGCCCCGCCGCCAUGCAUAUAUGGACGCCUAGUACCUCAGAAUGUGACUGUAUUUGGAAACAGGGCCUUUGAAGAAGUAAUUAAGUUAAAAUGAGGUCAUUAGGGUGGGCAGUAAUACAGUAUAACUGGUGUCCUUAUAAGAAGAGAUUAGGACACAGAUGCACACAGAGGGAAGACCAUAUGAACACAGAGGGAGAAGACAGCCACCUGCAAGCCACAGAGAGAGCCCUUCAAAGAAACCAACCCUGCAGACAAUUUGAUCUCAGGUUUCUGGCCUCCAGAAUUGUGAGAAAAUAAAUUUCUGUUGUUUAAGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications