Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 105 (SNORD105) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 105 (SNORD105) URS0000467AB5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD105: SNORD105 is a type of small nucleolar RNA. To investigate the effect of the rs2305789 polymorphism on SNORD105 expression, two SNORD105 vectors containing either the A or G allele were constructed and transfected into Huh7 and HepG2 cell lines [PMC8649375]. Reverse transcription primers for SNORD105 and U6 were designed and provided by Gene Pharma [PMC8649375]. The expression levels of SNORD105 and PPAN were examined in HCC tissue samples with different genotypes [PMC8649375]. A case-control study was conducted to evaluate the association between the SNP (rs2305789) within SNORD105 and HCC susceptibility in a Chinese population, as there is currently no research on polymorphism in SNORD105 and its function in HCC [PMC8649375]. The effect of SNORD105 on HCC cell proliferation was determined using an Enhanced Cell Counting Kit-8, following the manufacturer's instructions [PMC8649375].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCCUAUCUCUCAUGAUGAACACAUAUGCCUCUGAGCUGCUGUGAUUUCUGGCUUCAAAGUAAACGCUCUGAAGAAGAGAUGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications