Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-5128 URS00004670D7_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-5128: Mmu-mir-5128 is a differential miRNA that has been found to have lower levels in comparison to other miRNAs in certain groups [PMC9253011]. In bioinformatics analyses, Mthfr has been identified as a highly significant gene in relation to mmu-mir-5128 [PMC5342372]. Mmu-mir-5128 has also been found to target Cdip1, a gene involved in apoptosis and p53-mediated signaling [PMC5342372]. The expression of mmu-mir-5128 has been assayed using TaqMan MicroRNA Assays [PMC4569899]. In the context of OIR samples, mmu-mir-5128 was found to be downregulated [PMC6704537]. Mmu-mir-5128 has also been identified as one of the upregulated miRNAs in the DNCB 14 days group [PMC8698818]. It is one of the top three miRNA targets of CBXs and functions as an early-response miRNA [PMC9417237] [PMC6829453]. qRT-PCR was performed using miScript Primer Assays for mmu-mir-5128, among other miRNAs, for analysis purposes [PMC5159803]. Overall, these findings highlight the involvement and potential significance of mmu-mir-5128 in various biological processes and disease contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAUUGGGGCUGGCGAGAUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications