Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) microRNA dme-mir-31a precursor URS0000465605_7227

Automated summary: This pre miRNA sequence is 92 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (miRBase, FlyBase, ENA, RefSeq). Described in 16 papers. Matches 1 Rfam family (mir-31, RF00661). Drosophila melanogaster (fruit fly) microRNA dme-mir-31a precursor sequence is a product of mir-31a precursor, mir-31a, 31a precursor RNA, dme-mir-31a precursor, FBgn0262416, mir-31a precurso, mir-31a precursor RNA, 31a precursor RN genes. Found in the fruit fly reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCGUUGGUAAAUUGGCAAGAUGUCGGCAUAGCUGACGUUGAAAAGCGAUUUUGAAGAGCGCUAUGCUGCAUCUAGUCAGUUGUUCAAUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Drosophila sechellia microRNA dse-mir-31a precursor
    2. Drosophila simulans microRNA dsi-mir-31a precursor
    Publications New