Automated summary: This pre miRNA sequence is 92 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (miRBase, FlyBase, ENA, RefSeq). Described in 16 papers. Matches 1 Rfam family (mir-31, RF00661). Drosophila melanogaster (fruit fly) microRNA dme-mir-31a precursor sequence is a product of mir-31a precursor, mir-31a, 31a precursor RNA, dme-mir-31a precursor, FBgn0262416, mir-31a precurso, mir-31a precursor RNA, 31a precursor RN genes. Found in the fruit fly reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UCCGUUGGUAAAUUGGCAAGAUGUCGGCAUAGCUGACGUUGAAAAGCGAUUUUGAAGAGCGCUAUGCUGCAUCUAGUCAGUUGUUCAAUGGA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.