Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-17-3p URS00004636A3_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (LncBase, IntAct, miRBase, GeneCards, MalaCards, TarBase, ENA, RefSeq). Described in 65 papers. Homo sapiens (human) hsa-miR-17-3p sequence is a product of hsa-miR-17, hsa-miR-17-3p, MIR17, miR-17-3p, hsa-miR-17*, miR-17, miR-17* genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 101F6, 12CC4, 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 156DAG, 16A, 17b-HSD10, 182-FIP.

Interactions 3

According to IntAct, Homo sapiens (human) hsa-miR-17-3p interacts with:

IntAct ID Participant Synonyms
EBI-21198138 intact:EBI-21198129 EBI-21198129 ENST00000266085 mrna_timp3
EBI-21202116 intact:EBI-21202138 EBI-21202138 ENST00000301645 mrna_cyp7a1
EBI-979922 Q9UPY3 A7E2D3 B3KRG4 DICER DICER1 E0AD28 EBI-395506 HERNA Helicase with RNase motif KIAA0928 O95943 Q9UPY3 Q9UQ02 dicer_human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACUGCAGUGAAGGCACUUGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 8 other species

    1. Anolis carolinensis aca-miR-17-3p
    2. Canis lupus familiaris cfa-miR-17
    3. Cavia porcellus cpo-miR-17-3p
    4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-17-3p
    5. Ophiophagus hannah (king cobra) oha-miR-17-3p
    6. Oryctolagus cuniculus (rabbit) ocu-miR-17-3p
    7. Sus scrofa ssc-miR-17-3p
    8. Taeniopygia guttata tgu-miR-17a-3p
    9. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1683181