Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-17a-3p URS00004636A3_59729

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Taeniopygia guttata. Annotated by 2 databases (miRBase, RefSeq). Described in 4 papers. Taeniopygia guttata (zebra finch) tgu-miR-17a-3p sequence is a product of MIR17A, miR-17, miR-17a-3p, tgu-miR-17a-3p, tgu-miR-17a, miR-17a genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACUGCAGUGAAGGCACUUGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Anolis carolinensis aca-miR-17-3p
    2. Canis lupus familiaris (dog) cfa-miR-17
    3. Cavia porcellus cpo-miR-17-3p
    4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-17-3p
    5. Homo sapiens (human) hsa-miR-17-3p
    6. Ophiophagus hannah oha-miR-17-3p
    7. Oryctolagus cuniculus ocu-miR-17-3p
    8. Sus scrofa ssc-miR-17-3p
    9. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1683181