Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-17-3p URS0000460483_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGCAGUGAAGGCACUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Ateles geoffroyi (black-handed spider monkey) age-miR-17-3p
  2. Bos taurus bta-miR-17-3p
  3. Gallus gallus gga-miR-17-3p
  4. Gorilla gorilla gorilla ggo-miR-17-3p (MIR17)
  5. Gorilla gorilla ggo-miR-17-3p
  6. Homo sapiens (human) microRNA miR-17
  7. Lagothrix lagotricha (brown woolly monkey) lla-miR-17-3p
  8. Lemur catta lca-miR-17-3p
  9. Macaca mulatta mml-miR-17-3p
  10. Macaca nemestrina (pig-tailed macaque) mne-miR-17-3p
  11. Ornithorhynchus anatinus (platypus) oan-miR-17-3p
  12. Pan paniscus (pygmy chimpanzee) ppa-miR-17-3p
  13. Pan troglodytes ptr-miR-17-3p
  14. Saguinus labiatus sla-miR-17-3p
  15. Sus scrofa microRNA mir-17
  16. Xenopus tropicalis xtr-miR-17-3p