v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ZNFX1 antisense RNA 1 (ZFAS1) URS000045E7E2_9606

  • 1,008 nucleotides
  • 7 databases (Expression Atlas, GeneCards, HGNC, LNCipedia, MalaCards, NONCODE, RefSeq)
  • Found in 0 other species
  • 1071 publications
  • lncRNA
Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ZFAS1: ZFAS1 is a long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases, including bupivacaine-induced neurotoxicity and thyroid cancer [PMC8806570] [PMC7673324]. However, the exact role and molecular mechanism of ZFAS1 in bupivacaine-induced neurotoxicity are still unknown [PMC8806570]. It has been suggested that ZFAS1 may target miR-302a-3p to regulate the activity of thyroid carcinoma cells [PMC7673324]. In a study investigating the role of ZFAS1 in bupivacaine-induced neurotoxicity, it was found that upregulation of ZFAS1 increased cell viability and decreased apoptosis in bupivacaine-treated cells [PMC8806570]. Additionally, ZFAS1 was found to be upregulated in thyroid carcinoma tissue and associated with poor prognosis [PMC7673324] [PMC6492601]. In osteosarcoma, ZFAS1 was shown to be highly expressed and correlated with poor prognosis [PMC5732795] [PMC8974064]. Functional experiments demonstrated that upregulated ZFAS1 promoted osteosarcoma cell proliferation, migration, invasion, and metastasis both in vitro and in vivo [PMC6430496] [PMC8974064]. Furthermore, it has been suggested that ZFAS1 acts as a miRNA sponge to promote tumorigenesis or tumor progression in osteosarcoma by regulating various miRNAs such as miR-421 and miR-486 [PMC6380806] [PMC6640168] Additionally, lncRNAs such as ZFAS1 have been identified as potential therapeutic targets for bupivacaine-induced neurotoxicity treatment or diagnostic markers for thyroid cancer patients  [PMC8806570] [PMC6492601].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGGGGGCCCAGGGUGGAGAGCACGAGGGCCUGGCCCAGGCACGGCCGGCGCCUCCGCCCUCGAGGAGGGCGUCACCUCAGCUCCCCCCGGCGGCGGAGCCGGCGGGCUCAGGCGGGCGCGGCUGAGGGGAGCGGACCGCGGGGGGCGGGAGAUGACUGCGCCCAAGGCCUUUGCGGGCCUCAGCCGGCCCCAGAGGAAGGGGAACCCGUCGAGCGGUUUGGUGCGUGUGAAGCGCGACAUGGCGAGGAAGCGGACAAGCCCGGGUGGCCCGGCGUGUAGAGGGAAGGGGGCGGGGCUAGACGCGGCCUGGACAACUACUAGAGCGCCUCGGGCUGUGCUGCUCGAGACUACAUUUCCCAGAGCGACGCGCGCGGAGCGGGCGGGAAAGAGAGCGUUUCGGGUCCAGUGCGCAGGUGCGAAAGCCAUCUUUGGUUAUAUAAGGGAGGUUCAGGAAGCCAUUCGUUCUUUCGCGUCUGCGGUGCCCGGAGUGUGGUACUUCUCCUAGUUGCAGUCAGGCUUCAUACGCUAUUGUCCUGCCCGUUAGAGCAGCCAGCGGGUACAGAAUGGAUUUUGGAAGAGGGAGUCACCACUGGACCUCCAAGGAAGCCACGUGCAGACAUCUACAACCUUCGAUCUCCUGACGAGUUUAUUGUUGGCCAAAACCAGGCUUUGAUUGAACCAGGAUGAAUGCGGGUGUUGGAAGUAGAAUAUAUAUAUACAUAUAAAAUUGGUUGGGAGCCACGUGUACCAGUGUGUGUUGAUCUUGGCUUGAUUCAGUCUGCCUUGUAACAGAAACUGGCGAUGGAAUAUGAGAGGAGCCCUCUGGAAAGAAAAGGACAGACCCUGUGCUUUCAUGAAAGUGAAGAUCUGGCUGAACCAGUUCCACAAGGUUACUGUAUACAUAGCCUGAGUUUAAAAGGCUGUGCCCACUUCAAGAAUGUCAUUGUUAGACUUUGAAAUUUCUAACUGCCUACCUGCAUAAAGAAAAUAAAAUCUUUUAAAUCAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications