Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA Isoleucine with anticodon TAT (tRNA-Ile-TAT-1-1) secondary structure diagram

Saccharomyces cerevisiae S288C tRNA Isoleucine with anticodon TAT (tRNA-Ile-TAT-1-1) URS000045E5E5_559292

Automated summary: This ncRNA sequence is 73 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 2 databases (ENA, IntAct). Described in 8 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C tRNA Isoleucine with anticodon TAT (tRNA-Ile-TAT-1-1) sequence is a product of tRNA-Ile-TAT-1-1 gene.

Interactions 3

According to IntAct, Saccharomyces cerevisiae S288C tRNA Isoleucine with anticodon TAT (tRNA-Ile-TAT-1-1) interacts with:

IntAct ID Participant Synonyms
EBI-12517731 P38205 D6VPX6 EBI-11933 Multisite-specific tRNA:m5C-methyltransferase NCL1 P38205 TRM4 YBL024W YBL0437 ncl1_yeast tRNA (cytosine-5-)-methyltransferase NCL1 tRNA methyltransferase 4
EBI-12559706 P53738 D6W1M1 EBI-28520 N3445 P53738 TRM112 YNR046W eRF1 methyltransferase subunit TRM112 tRNA methyltransferase 112 tr112_yeast
EBI-11703613 Q12211 D6W3F8 EBI-14272 PUS1 Q12211 YPL212C pus1_yeast tRNA pseudouridylate synthase 1 tRNA-uridine isomerase 1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCUCGUGUAGCUCAGUGGUUAGAGCUUCGUGCUUAUAACGCGACCGUCGUGGGUUCAAACCCCACCUCGAGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 91 other species

    1. [Candida] glabrata tRNA-Ile
    2. Kazachstania saulgeensis transfer RNA-Ile-(TAT)
    3. Saccharomyces cerevisiae (baker's yeast) transfer RNA-Ile-2
    4. Saccharomyces cerevisiae PE-2 tRNA-Ile
    5. Saccharomyces cerevisiae YJM1078 tRNA-Ile
    6. Saccharomyces cerevisiae YJM1083 tRNA-Ile
    7. Saccharomyces cerevisiae YJM1129 tRNA-Ile
    8. Saccharomyces cerevisiae YJM1190 tRNA-Ile
    9. Saccharomyces cerevisiae YJM1199 tRNA-Ile
    10. Saccharomyces cerevisiae YJM1202 tRNA-Ile
    11. Saccharomyces cerevisiae YJM1208 tRNA-Ile
    12. Saccharomyces cerevisiae YJM1242 tRNA-Ile
    13. Saccharomyces cerevisiae YJM1244 tRNA-Ile
    14. Saccharomyces cerevisiae YJM1248 tRNA-Ile
    15. Saccharomyces cerevisiae YJM1250 tRNA-Ile
    16. Saccharomyces cerevisiae YJM1252 tRNA-Ile
    17. Saccharomyces cerevisiae YJM1273 tRNA-Ile
    18. Saccharomyces cerevisiae YJM1304 tRNA-Ile
    19. Saccharomyces cerevisiae YJM1307 tRNA-Ile
    20. Saccharomyces cerevisiae YJM1311 tRNA-Ile
    21. Saccharomyces cerevisiae YJM1326 tRNA-Ile
    22. Saccharomyces cerevisiae YJM1332 tRNA-Ile
    23. Saccharomyces cerevisiae YJM1336 tRNA-Ile
    24. Saccharomyces cerevisiae YJM1338 tRNA-Ile
    25. Saccharomyces cerevisiae YJM1341 tRNA-Ile
    26. Saccharomyces cerevisiae YJM1342 tRNA-Ile
    27. Saccharomyces cerevisiae YJM1355 tRNA-Ile
    28. Saccharomyces cerevisiae YJM1356 tRNA-Ile
    29. Saccharomyces cerevisiae YJM1381 tRNA-Ile
    30. Saccharomyces cerevisiae YJM1383 tRNA-Ile
    31. Saccharomyces cerevisiae YJM1385 tRNA-Ile
    32. Saccharomyces cerevisiae YJM1386 tRNA-Ile
    33. Saccharomyces cerevisiae YJM1387 tRNA-Ile
    34. Saccharomyces cerevisiae YJM1388 tRNA-Ile
    35. Saccharomyces cerevisiae YJM1389 tRNA-Ile
    36. Saccharomyces cerevisiae YJM1399 tRNA-Ile
    37. Saccharomyces cerevisiae YJM1400 tRNA-Ile
    38. Saccharomyces cerevisiae YJM1401 tRNA-Ile
    39. Saccharomyces cerevisiae YJM1402 tRNA-Ile
    40. Saccharomyces cerevisiae YJM1415 tRNA-Ile
    41. Saccharomyces cerevisiae YJM1417 tRNA-Ile
    42. Saccharomyces cerevisiae YJM1418 tRNA-Ile
    43. Saccharomyces cerevisiae YJM1419 tRNA-Ile
    44. Saccharomyces cerevisiae YJM1433 tRNA-Ile
    45. Saccharomyces cerevisiae YJM1434 tRNA-Ile
    46. Saccharomyces cerevisiae YJM1439 tRNA-Ile
    47. Saccharomyces cerevisiae YJM1443 tRNA-Ile
    48. Saccharomyces cerevisiae YJM1444 tRNA-Ile
    49. Saccharomyces cerevisiae YJM1460 tRNA-Ile
    50. Saccharomyces cerevisiae YJM1463 tRNA-Ile
    51. Saccharomyces cerevisiae YJM1477 tRNA-Ile
    52. Saccharomyces cerevisiae YJM1478 tRNA-Ile
    53. Saccharomyces cerevisiae YJM1479 tRNA-Ile
    54. Saccharomyces cerevisiae YJM1526 tRNA-Ile
    55. Saccharomyces cerevisiae YJM1527 tRNA-Ile
    56. Saccharomyces cerevisiae YJM1549 tRNA-Ile
    57. Saccharomyces cerevisiae YJM1573 tRNA-Ile
    58. Saccharomyces cerevisiae YJM1574 tRNA-Ile
    59. Saccharomyces cerevisiae YJM1592 tRNA-Ile
    60. Saccharomyces cerevisiae YJM1615 tRNA-Ile
    61. Saccharomyces cerevisiae YJM189 tRNA-Ile
    62. Saccharomyces cerevisiae YJM193 tRNA-Ile
    63. Saccharomyces cerevisiae YJM195 tRNA-Ile
    64. Saccharomyces cerevisiae YJM244 tRNA-Ile
    65. Saccharomyces cerevisiae YJM248 tRNA-Ile
    66. Saccharomyces cerevisiae YJM270 tRNA-Ile
    67. Saccharomyces cerevisiae YJM271 tRNA-Ile
    68. Saccharomyces cerevisiae YJM320 tRNA-Ile
    69. Saccharomyces cerevisiae YJM326 tRNA-Ile
    70. Saccharomyces cerevisiae YJM428 tRNA-Ile
    71. Saccharomyces cerevisiae YJM450 tRNA-Ile
    72. Saccharomyces cerevisiae YJM451 tRNA-Ile
    73. Saccharomyces cerevisiae YJM453 tRNA-Ile
    74. Saccharomyces cerevisiae YJM456 tRNA-Ile
    75. Saccharomyces cerevisiae YJM470 tRNA-Ile
    76. Saccharomyces cerevisiae YJM541 tRNA-Ile
    77. Saccharomyces cerevisiae YJM554 tRNA-Ile
    78. Saccharomyces cerevisiae YJM555 tRNA-Ile
    79. Saccharomyces cerevisiae YJM627 tRNA-Ile
    80. Saccharomyces cerevisiae YJM682 tRNA-Ile
    81. Saccharomyces cerevisiae YJM683 tRNA-Ile
    82. Saccharomyces cerevisiae YJM689 tRNA-Ile
    83. Saccharomyces cerevisiae YJM969 tRNA-Ile
    84. Saccharomyces cerevisiae YJM972 tRNA-Ile
    85. Saccharomyces cerevisiae YJM975 tRNA-Ile
    86. Saccharomyces cerevisiae YJM978 tRNA-Ile
    87. Saccharomyces cerevisiae YJM981 tRNA-Ile
    88. Saccharomyces cerevisiae YJM984 tRNA-Ile
    89. Saccharomyces cerevisiae YJM987 tRNA-Ile
    90. Saccharomyces cerevisiae YJM990 tRNA-Ile
    91. Saccharomyces cerevisiae YJM993 tRNA-Ile
    92. Saccharomyces cerevisiae YJM996 tRNA-Ile
    2D structure New