v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) Cfa-Mir-154-P27_3p (mature (guide)) URS000045B99E_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUAAUAUCGGACAACCAUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-889
  2. Cavia porcellus cpo-miR-889-3p
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-889-3p
  4. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P27_3p (mature (guide))
  5. Equus caballus eca-miR-889
  6. Homo sapiens hsa-miR-889-3p
  7. Macaca mulatta (Rhesus monkey) mml-miR-889-3p
  8. Oryctolagus cuniculus (rabbit) ocu-miR-889-3p
  9. Pan paniscus (pygmy chimpanzee) ppa-miR-889
  10. Pan troglodytes ptr-miR-889
  11. Pongo pygmaeus ppy-miR-889
  12. Pteropus alecto pal-miR-889-3p