Drosophila virilis dvi-miR-275-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila virilis dvi-miR-275-3p URS000045B410_7244

23 nucleotides
2 databases (Ensembl Metazoa, miRBase)
Found in 29 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCAGGUACCUGAAGUAGCGCGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

Aedes aegypti Aae-Mir-275_3p (mature (guide))
Anopheles gambiae aga-miR-275
Apis mellifera (honey bee) ame-miR-275-3p
Bactrocera dorsalis (oriental fruit fly) bdo-miR-275
Blattella germanica (German cockroach) Bge-Mir-275_3p (mature (guide))
Bombyx mori bmo-miR-275-3p
Cochliomyia hominivorax mature cho-miR-275-3p
Cochliomyia macellaria (secondary screw-worm) mature cma-miR-275-3p
Daphnia magna Dma-Mir-275_3p (mature (guide))
Daphnia pulex (common water flea) dpu-miR-275
Drosophila ananassae dan-miR-275
Drosophila erecta der-miR-275
Drosophila grimshawi dgr-miR-275
Drosophila melanogaster (fruit fly) dme-miR-275-3p
Drosophila mojavensis dmo-miR-275
Drosophila persimilis dpe-miR-275
Drosophila pseudoobscura dps-miR-275
Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294447_df_nrg
Drosophila sechellia dse-miR-275
Drosophila simulans dsi-miR-275
Drosophila willistoni dwi-miR-275
Drosophila yakuba dya-miR-275
Heliconius melpomene (postman butterfly) Hme-Mir-275_3p (mature (guide))
Ixodes scapularis (black-legged tick) isc-miR-275
Manduca sexta mse-miR-275
Nasonia giraulti ngi-miR-275
Nasonia longicornis nlo-miR-275
Nasonia vitripennis nvi-miR-275
Tribolium castaneum (red flour beetle) tca-miR-275-3p