Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294447_df_nrg URS000045B410_46245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGUACCUGAAGUAGCGCGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Aedes aegypti Aae-Mir-275_3p (mature (guide))
  2. Anopheles gambiae aga-miR-275
  3. Apis mellifera (honey bee) ame-miR-275-3p
  4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-275
  5. Blattella germanica (German cockroach) Bge-Mir-275_3p (mature (guide))
  6. Bombyx mori bmo-miR-275-3p
  7. Cochliomyia hominivorax mature cho-miR-275-3p
  8. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-275-3p
  9. Daphnia magna Dma-Mir-275_3p (mature (guide))
  10. Daphnia pulex (common water flea) dpu-miR-275
  11. Drosophila ananassae dan-miR-275
  12. Drosophila erecta der-miR-275
  13. Drosophila grimshawi dgr-miR-275
  14. Drosophila melanogaster (fruit fly) dme-miR-275-3p
  15. Drosophila mojavensis dmo-miR-275
  16. Drosophila persimilis dpe-miR-275
  17. Drosophila pseudoobscura dps-miR-275
  18. Drosophila sechellia dse-miR-275
  19. Drosophila simulans dsi-miR-275
  20. Drosophila virilis dvi-miR-275-3p
  21. Drosophila willistoni dwi-miR-275
  22. Drosophila yakuba dya-miR-275
  23. Heliconius melpomene (postman butterfly) Hme-Mir-275_3p (mature (guide))
  24. Ixodes scapularis (black-legged tick) isc-miR-275
  25. Manduca sexta mse-miR-275
  26. Nasonia giraulti ngi-miR-275
  27. Nasonia longicornis nlo-miR-275
  28. Nasonia vitripennis nvi-miR-275
  29. Tribolium castaneum (red flour beetle) tca-miR-275-3p