v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-275-3p URS000045B410_7091

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Bombyx mori. Annotated by 4 databases (PirBase, ENA, RefSeq, miRBase). Bombyx mori (domestic silkworm) bmo-miR-275-3p sequence is a product of miR-275, Mir275, bmo-miR-275, miR-275-3p, bmo-miR-275-3p genes. Found in the Bombyx mori reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UCAGGUACCUGAAGUAGCGCGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Aedes aegypti Aae-Mir-275_3p (mature (guide))
    2. Anopheles gambiae aga-miR-275
    3. Apis mellifera ame-miR-275-3p
    4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-275
    5. Blattella germanica Bge-Mir-275_3p (mature (guide))
    6. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-275-3p
    7. Cochliomyia macellaria mature cma-miR-275-3p
    8. Daphnia magna Dma-Mir-275_3p (mature (guide))
    9. Daphnia pulex dpu-miR-275
    10. Drosophila ananassae dan-miR-275
    11. Drosophila erecta der-miR-275
    12. Drosophila grimshawi dgr-miR-275
    13. Drosophila melanogaster (fruit fly) dme-miR-275-3p
    14. Drosophila mojavensis dmo-miR-275
    15. Drosophila persimilis dpe-miR-275
    16. Drosophila pseudoobscura dps-miR-275
    17. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294447_df_nrg
    18. Drosophila sechellia dse-miR-275
    19. Drosophila simulans dsi-miR-275
    20. Drosophila virilis dvi-miR-275-3p
    21. Drosophila willistoni dwi-miR-275
    22. Drosophila yakuba dya-miR-275
    23. Heliconius melpomene Hme-Mir-275_3p (mature (guide))
    24. Ixodes scapularis (black-legged tick) isc-miR-275
    25. Manduca sexta mse-miR-275
    26. Nasonia giraulti ngi-miR-275
    27. Nasonia longicornis nlo-miR-275
    28. Nasonia vitripennis nvi-miR-275
    29. Tribolium castaneum (red flour beetle) tca-miR-275-3p
     Publications