Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bactrocera dorsalis (oriental fruit fly) bdo-miR-999 URS000045B25B_27457

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUUAACUGUAAGACUGUGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Aedes aegypti aae-miR-999
  2. Cochliomyia hominivorax mature cho-miR-999
  3. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-999
  4. Culex quinquefasciatus (southern house mosquito) cqu-miR-999
  5. Drosophila ananassae Dan-Mir-999_3p (mature (guide))
  6. Drosophila melanogaster (fruit fly) dme-miR-999-3p
  7. Drosophila mojavensis Dmo-Mir-999_3p (mature (guide))
  8. Drosophila simulans dsi-miR-999-3p
  9. Drosophila virilis dvi-miR-999-3p
  10. Drosophila yakuba Dya-Mir-999_3p (mature (guide))