Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-15b-3p URS000045A9D7_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-15b: Mmu-mir-15b is a murine miRNA that has been suggested to regulate Ca2+ pathways by targeting STIM1/2 proteins through a strong binding site in the 3’UTR of STIM2 [PMC5685687]. To confirm this, murine CD4+ T cells were transfected with mmu-mir-15b mimic and the transcript levels of STIM2 and Orai1 were measured [PMC5685687]. The expression of mmu-mir-15b was found to significantly inhibit luciferase activity, indicating its regulatory role [PMC5544724]. The expression of mmu-mir-15b was also found to be elevated by 5’-AZA-dC, which reduced methylation levels in the CGI shore region of mmu-mir-15b [PMC5544724]. Mmu-miR-15a, mmu-mir-15b, and mmu-miR-16 have been implicated in the regulation of cell proliferation and apoptosis [PMC2244641]. In a study on infection, several miRNAs including mmu-miR-146b, mmu-miR-155, mmu-miR-223, mmu-miR1423p, mmumir - 15 b , and m m u - m i R - 126 -5p were significantly up-regulated during the mid-phase (30 dpi) [PMC3692539].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGAAUCAUUAUUUGCUGCUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Dasypus novemcinctus (nine-banded armadillo) dno-miR-15b-3p
  2. Homo sapiens hsa-miR-15b-3p
  3. Macaca mulatta (Rhesus monkey) mml-miR-15b-3p
  4. Pteropus alecto pal-miR-15b-3p
  5. Rattus norvegicus rno-miR-15b-3p
Publications