Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR166d-5p URS0000457229_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR166d-5p: A study identified 15 differentially expressed miRNAs and their target genes, including osa-mir166d-5p, in non-infected and infected treatments at different stages [PMC9222952]. The expression of osa-mir166d-5p was found to be decreased in the LDS and REC root of N22, as well as in the SDS and REC root of N22 [PMC5447883]. Several miRNAs, including osa-mir166d-5p, have been suggested to be regulated under abiotic or biotic stresses [PMC4723043]. In infected plants, osa-mir166d-5p was found to be up-regulated and more abundant compared to healthy plants [PMC4723043]. The expression of osa-mir166d-5p was inhibited during heat treatment in the tolerant variety Nagina 22 [PMC7709044]. Both osa-mir166d-5p and another miRNA called osa-miR2097-3p were found to be involved in plant resistance to viruses [PMC7709044]. In response to rice stripe virus infection, the expression of osa-mir166d-5p increased significantly [PMC7709044]. Additionally, the Fold Change of osa-mir166d-5p was less than -4 upon infection with rice stripe virus [PMC4628322]. In susceptible plants infected with rice stripe virus, 20 miRNAs including osa-mir166d-5p were upregulated [PMC5897953].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAAUGUUGUCUGGCUCGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR166c-5p
  2. Brachypodium distachyon bdi-miR166e-5p
  3. Camelina sativa (false flax) cas-miR166a
  4. Citrus sinensis (sweet orange) csi-miR166a-5p
  5. Corchorus capsularis sRNA CCACVL1_13346
  6. Cynara cardunculus var. scolymus cca-miR166d
  7. Eugenia uniflora (Brazil-cherry) eun-miR166-5p
  8. Glycine max gma-miR166a-5p
  9. Medicago truncatula mtr-miR166g-5p
  10. Oryza sativa Japonica Group microRNA osa-miR166d-5p
  11. Prunus persica (peach) microRNA miRNA_353
  12. Solanum tuberosum (potato) stu-miR166a-5p
  13. Vriesea carinata vca-miR166b-5p
  14. Zea mays (maize) zma-miR166c-5p
Publications