Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brachypodium distachyon (stiff brome) bdi-miR166e-5p URS0000457229_15368

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAAUGUUGUCUGGCUCGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR166c-5p
  2. Camelina sativa (false flax) cas-miR166a
  3. Citrus sinensis (sweet orange) csi-miR166a-5p
  4. Corchorus capsularis sRNA CCACVL1_13346
  5. Cynara cardunculus var. scolymus cca-miR166d
  6. Eugenia uniflora (Brazil-cherry) eun-miR166-5p
  7. Glycine max gma-miR166a-5p
  8. Medicago truncatula mtr-miR166g-5p
  9. Oryza sativa (Asian cultivated rice) osa-miR166d-5p
  10. Oryza sativa Japonica Group microRNA osa-miR166d-5p
  11. Prunus persica (peach) microRNA miRNA_353
  12. Solanum tuberosum (potato) stu-miR166a-5p
  13. Vriesea carinata vca-miR166b-5p
  14. Zea mays (maize) zma-miR166c-5p
Publications