Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Eugenia uniflora eun-miR166-5p URS0000457229_119951

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Eugenia uniflora. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGAAUGUUGUCUGGCUCGAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 95 other species

    1. Arabidopsis lyrata aly-miR166a-5p
    2. Brachypodium distachyon bdi-miR166e-5p
    3. Camelina sativa (false flax) cas-miR166a
    4. Citrus sinensis csi-miR166e-5p
    5. Corchorus capsularis (jute) sRNA CCACVL1_13346
    6. Cynara cardunculus var. scolymus cca-miR166d
    7. Glycine max gma-miR166a-5p
    8. Medicago truncatula mtr-miR166g-5p
    9. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR166d-5p
    10. Oryza sativa osa-miR166d-5p
    11. Prunus persica (peach) microRNA miRNA_353
    12. Solanum tuberosum stu-miR166a-5p
    13. Vriesea carinata vca-miR166b-5p
    14. Zea mays zma-miR166c-5p