Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-490-5p URS00004556E5_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAUGGAUCUCCAGGUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-490_5p (mature (co-guide))
  2. Anolis carolinensis (green anole) aca-miR-490-5p
  3. Cavia porcellus (domestic guinea pig) cpo-miR-490-5p
  4. Chrysemys picta cpi-miR-490-5p
  5. Equus caballus eca-miR-490-5p
  6. Gallus gallus (chicken) gga-miR-490-5p
  7. Homo sapiens (human) hsa-miR-490-5p
  8. Macaca mulatta mml-miR-490-5p
  9. Mus musculus (house mouse) mmu-miR-490-5p
  10. Ophiophagus hannah oha-miR-490-5p
  11. Ornithorhynchus anatinus (platypus) oan-miR-490-5p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-490-5p
  13. Pongo pygmaeus ppy-miR-490-5p
  14. Pteropus alecto pal-miR-490-5p
  15. Rattus norvegicus rno-miR-490-5p
  16. Taeniopygia guttata tgu-miR-490-5p