Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-490-5p URS00004556E5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-490: Hsa-mir-490 is a microRNA that has been relatively less studied in the context of tumor formation and progression in breast cancer [PMC5013276]. Low expression of hsa-mir-490 has been associated with reduced patient survival in hepatocellular carcinoma [PMC10083302]. In lung adenocarcinoma, hsa-mir-490 has been found to be associated with prognosis, along with other mRNAs, lncRNAs, and miRNAs [PMC7314420]. Limited information is available regarding the regulatory role of hsa-mir-490 in Wilms tumor, but high expression of hsa-mir-490 has been related to high survival rates in patients [PMC6668497]. In breast cancer patients, hsa-mir-490 is one of the miRNAs significantly correlated with overall survival [PMC6692470]. In a study on ovarian cancer drug resistance, hsa-mir-490 was found to play a potential role [PMC5123339]. Additionally, hsa-mir-490 has been identified as one of the miRNAs that may have an important regulatory role in HER2 breast cancer and its associated pathways [PMC5123339]. Overall, while there is relatively less research on hsa-mir-490 compared to other miRNAs, its expression and association with prognosis have been studied in various types of cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAUGGAUCUCCAGGUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-490_5p (mature (co-guide))
  2. Anolis carolinensis (green anole) aca-miR-490-5p
  3. Cavia porcellus (domestic guinea pig) cpo-miR-490-5p
  4. Chrysemys picta cpi-miR-490-5p
  5. Dasypus novemcinctus dno-miR-490-5p
  6. Equus caballus eca-miR-490-5p
  7. Gallus gallus (chicken) gga-miR-490-5p
  8. Macaca mulatta mml-miR-490-5p
  9. Mus musculus (house mouse) mmu-miR-490-5p
  10. Ophiophagus hannah oha-miR-490-5p
  11. Ornithorhynchus anatinus (platypus) oan-miR-490-5p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-490-5p
  13. Pongo pygmaeus ppy-miR-490-5p
  14. Pteropus alecto pal-miR-490-5p
  15. Rattus norvegicus rno-miR-490-5p
  16. Taeniopygia guttata tgu-miR-490-5p
Publications