Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-767-5p URS000045147B_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, ENA, PSICQUIC, LncBase, RefSeq, GeneCards, TarBase, miRBase). Described in 21 papers. Homo sapiens (human) hsa-miR-767-5p sequence is a product of MIR767, hsa-miR-767-5p, hsa-miR-767, miR-767, miR-767-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 80K-L, AGO, ALG1, ANILLIN, ANKRD13B, ANKRD52, ANLN, ANP32E, API1, ARFGEF2.

Interactions 8

According to PSICQUIC, Homo sapiens (human) hsa-miR-767-5p interacts with:

Interaction id Participant Synonyms
URS000045147B_9606-0 P02461 P02461
URS000045147B_9606-4 P02461 P02461
URS000045147B_9606-5 P02462 P02462
URS000045147B_9606-1 P02462 P02462
URS000045147B_9606-2 P05997 P05997
URS000045147B_9606-6 P05997 P05997
URS000045147B_9606-3 Q03692 Q03692
URS000045147B_9606-7 Q03692 Q03692

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGCACCAUGGUUGUCUGAGCAUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 9 other species

    1. Bos taurus (cattle) bta-miR-767
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-767
    3. Equus caballus eca-miR-767-5p
    4. Macaca mulatta mml-miR-767-5p
    5. Pongo pygmaeus ppy-miR-767-5p