v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-421 URS00004505E4_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUCAACAGACAUUAAUUGGGCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus (cattle) bta-miR-421
  2. Canis lupus familiaris (dog) Cfa-Mir-95-P2_3p (mature (guide))
  3. Capra hircus (goat) chi-miR-421-3p
  4. Cervus elaphus cel-miR-421
  5. Homo sapiens (human) hsa-miR-421
  6. Macaca mulatta (Rhesus monkey) mml-miR-421
  7. Mus musculus (house mouse) mmu-miR-421-3p
  8. Nomascus leucogenys nle-miR-421
  9. Oryctolagus cuniculus ocu-miR-421-3p
  10. Pan troglodytes ptr-miR-421
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-421
  12. Sus scrofa ssc-miR-421-3p