Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-421 URS00004505E4_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (LncBase, TarBase, ENA, miRBase, RefSeq, GeneCards). Described in 50 papers. Homo sapiens (human) hsa-miR-421 sequence is a product of miR-421, MIR421, hsa-miR-421 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 133K02, 182-FIP, 3pK, 4F2, 4F2HC, 4T2HC, 82-FIP, 87U6, ABBP1.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUCAACAGACAUUAAUUGGGCGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Bos taurus bta-miR-421
    2. Callithrix jacchus cja-miR-421
    3. Canis lupus familiaris Cfa-Mir-95-P2_3p (mature (guide))
    4. Capra hircus (goat) chi-miR-421-3p
    5. Cervus elaphus (red deer) cel-miR-421
    6. Macaca mulatta mml-miR-421
    7. Mus musculus mmu-miR-421-3p
    8. Nomascus leucogenys nle-miR-421
    9. Oryctolagus cuniculus (rabbit) ocu-miR-421-3p
    10. Pan troglodytes ptr-miR-421
    11. Pongo pygmaeus (Bornean orangutan) ppy-miR-421
    12. Sus scrofa ssc-miR-421-3p