v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 885 (LINC00885) URS000044FC51_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00885: LINC00885 is a long non-coding RNA (lncRNA) that has been implicated in various aspects of cancer development and progression. In the context of papillary cervical cancer (CC) tumorigenesis, a study provided novel insights into the function of FOXP3 and LINC00885 [PMC8072316]. Through bioinformatics analysis, four miRNAs were identified as potential interactors with LINC00885, with miR-3150b-3p being downregulated in CC cells, suggesting its involvement in the modulation mechanism of LINC00885 in CC cells [PMC8744347]. It is proposed that LINC00885 contributes to cervical cancer malignancy through the competing endogenous RNA (ceRNA) mechanism [PMC7886091]. Functional experiments demonstrated that deficiency of LINC00885 hindered cervical cancer cell proliferation, migration, and invasion while stimulating apoptosis in vitro [PMC7886091]. Further investigation into other cancer cell lines and in vivo models may provide additional insights into the role of LINC00885 in breast cancer development and progression [PMC7582527]. The sequences of PCR primers used to study LINC00885 were provided as: forward primer 5′-CAGGGTTGGTGCTATGAATGAC-3′ and reverse primer 5′-GAAGATTGTCCATGTTGGCAGTAT-3′ [PMC8072316]. Overall, these findings suggest that LINC00885 may function as an oncogenic gene in CC [PMC8072316], inducing premalignant phenotypic changes such as increased cell proliferation, motility, migration, and altered 3D growth in normal breast epithelial and DCIS cells [PMC7582527].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUUCUGGUGAGAGAAAGCUGAGCAGAAUGGAUCUAAUCUGAUUCCUCCACCCAGAAGCCCUUAAAAUGCAGCUUUGUUUUAAGCCUUCUUGAAGAUUUGGGCUAGAUCUAGAAAAGAACCUCACCACGGAGGAUGUGCAAAGUACAACACGUGACCCCGGAGACGGAAGCUCUUCUCUACCUCCGUAAAGAUGAUCUCUGAUGAACAGACAUGAUCAUGCCUGGAGAACAGGGAUGGACAGUCCCGCUUCUGAAAGACCCUGUCUGGCUGAUGAUUCAUGGUGCGCCGGGCAGACCCCAGGCCAAGAGACCCCACCCACAGUACCUGAGUGCUCAGCUGGGAACCAGACCAGACCUCAAAACAGGUUCCCAAGGUUACCACCCAACCCUGCCAACUUUCGCACCCCGCAAGGAGCAAGACCCCGCCCGCUCACCACCUGCCUGUGCAGCCAACGGGCCUCGCUGAGCUGCCCUGGGCCGCUCCCUCCAUUCACACAGUUGGCCCUCCCUCUCCCUGCCUCCCUUCGCCUACCCCACGAACUACUUCAUCCCUCUGGGCCGGCACUGUAGAAGCCCCAUUGUUCACAUCGACCUCCCAAUUAUCUCCUCUUUCCCUCUCCCUCUGCUCCUGCCCAGACCAGCCCCCCAGCAUUGACCUGGAUGCCUGCCACAGCCUCCUCCCUGGUCUCCGGCCUCCCACCUCUGCUCCUCGGUCUCCUCUACCCAGCCAGUAACUGCAGAGAGCACUAAAGCACAGUCCUGGCAUCUCACCCCCUUAACCCUGGCCACGGCUUCCCAGUGCCUCCAAGAUAAAGCACCAACACCUGAGGACAGCAGCUUGUUUUGAGAGUCCCCUCCAUUGAAACACGCACAUCUAAUUUGUCCUUCAGUUCGCUGGACUCCACGCUGAACGUGCCAUGCUCCAUUGCCCCGUGAGUAACUCCAUGCUCUUGCCGGUUUCACACGGCCUCUCAGAGCUGGAGCCUUUGUUCAGGAGCCCUGGGCAGCUUUCAGGAAGCUCUUGGGCUCAUCAGCUUCCUCUGGCUGAAGCCGCCCCAGUGGAAUCAUGGGGAUUUCUUACUUUGAAGGUGGGGCCACCCGCAGACUGUAACCGGCUGGUUCAAGAUCAAGGACUUCCCCAGGCCACCUGCCUCAGAGGCAAGAAAGGCUCAGCUGAGUCCCAGACACUCCUCGCUGUGGCCCCUCCUUCCUCCCUGCUGGGCAGGCCCCCCUCAAUUCUGUUUGCCAGCAGGGCCUAGUAACACUGAAAGACGAAAAGGGAAAUAAAAUAAACACAAUUAAUAGGCUAAAGGUUACUGAAUAAAGUGGCAGCAGUAAAUAAAUUGACUACUGUGCAAAUACAAAGACAUGAAGACAUGAAACCCCUGCUCUAAAUGACCACUCACCAAGAGCAAGGCCUGGGCUGGAGGCAGGGAGCACCUCCCUAAGGAGCACUCCCUCUUUCCCGGAGUGAGUCCUCCUUCUAGAUGGAAUUCAGUCCGGGUUCCUCUUGAGCCACAGUCCCUGUUGGGGCCUAUCUCAGUGGACUCAAGAUCCUGAACUUCUUCCAGAUUGCUGACUACACAUUUGAGUCACCCAGAGAUUAAAAGAAAAAACAAAUAAUUUCCCAGUGAUCAGGAGUAAAUCAGCUGGGGCAGGGUUGGUGCUAUGAAUGACCACACUGAUUUGUACACUUCACUGAUUUGUAGUGUUUGCUAUUUCCGUCGUGUAAAUACUGCCAACAUGGACAAUCUUCAGUUGCUAAUGGUUUACUAACUGGCUUGUAAAUGAAUUCAUUCAGUAUUCAAGAAAAUGGCACUACAUUUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications