Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-278-3p URS000044F6FB_7227

Automated summary: This piRNA sequence is 22 nucleotides long and is found in Drosophila melanogaster. Annotated by 6 databases (ENA, RefSeq, PirBase, FlyBase, miRBase, MirGeneDB). Described in 13 papers. Drosophila melanogaster (fruit fly) dme-miR-278-3p sequence is a product of FBgn0262403, 278-R, dme-miR-278-3p, 278-RA, miR-278-3p, dme-miR-278, miR-278, mir-278, mir-278-RA genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGGUGGGACUUUCGUCCGUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Aedes aegypti aae-miR-278-3p
    2. Anopheles gambiae (African malaria mosquito) aga-miR-278
    3. Apis mellifera (honey bee) ame-miR-278-3p
    4. Blattella germanica (German cockroach) Bge-Mir-278_3p (mature (guide))
    5. Culex quinquefasciatus (southern house mosquito) cqu-miR-278
    6. Dasypus novemcinctus Dan-Mir-278_3p (mature (co-guide))
    7. Dinoponera quadriceps dqu-miR-278-3p
    8. Drosophila ananassae dan-miR-278
    9. Drosophila erecta der-miR-278
    10. Drosophila grimshawi dgr-miR-278
    11. Drosophila mojavensis dmo-miR-278
    12. Drosophila persimilis dpe-miR-278
    13. Drosophila pseudoobscura dps-miR-278
    14. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294445_df_nrg
    15. Drosophila sechellia dse-miR-278
    16. Drosophila simulans dsi-miR-278
    17. Drosophila virilis dvi-miR-278-3p
    18. Drosophila willistoni dwi-miR-278
    19. Drosophila yakuba dya-miR-278
    20. Polistes canadensis pca-miR-278-3p