Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Culex quinquefasciatus (southern house mosquito) cqu-miR-278 URS000044F6FB_7176

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Culex quinquefasciatus. Annotated by 1 database (miRBase). Found in the Culex quinquefasciatus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCGGUGGGACUUUCGUCCGUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Aedes aegypti aae-miR-278-3p
    2. Anopheles gambiae aga-miR-278
    3. Apis mellifera ame-miR-278-3p
    4. Blattella germanica Bge-Mir-278_3p (mature (guide))
    5. Dinoponera quadriceps dqu-miR-278-3p
    6. Drosophila ananassae dan-miR-278
    7. Drosophila erecta der-miR-278
    8. Drosophila grimshawi dgr-miR-278
    9. Drosophila melanogaster (fruit fly) dme-miR-278-3p
    10. Drosophila mojavensis dmo-miR-278
    11. Drosophila persimilis dpe-miR-278
    12. Drosophila pseudoobscura dps-miR-278
    13. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294445_df_nrg
    14. Drosophila sechellia dse-miR-278
    15. Drosophila simulans dsi-miR-278
    16. Drosophila virilis dvi-miR-278-3p
    17. Drosophila willistoni dwi-miR-278
    18. Drosophila yakuba dya-miR-278
    19. Polistes canadensis pca-miR-278-3p