Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) microRNA dme-mir-985 precursor URS000044EC9C_7227

Automated summary: This pre miRNA sequence is 86 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (miRBase, ENA, FlyBase, RefSeq). Described in 14 papers. Drosophila melanogaster (fruit fly) microRNA dme-mir-985 precursor sequence is a product of mir-985 precursor RNA, 985 precursor RNA, mir-985, FBgn0262283, mir-985 precurso, dme-mir-985 precursor, mir-985 precursor, 985 precursor RN genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUAUAAUAGCACUGCUGGCUCAUUGGUACAUUUCAUAAGUACCUUAUCAAAUGUUCCAAUGGUCGGGCAGAGCUAUUAUUUGUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.