Automated summary: This pre miRNA sequence is 97 nucleotides long and is found in Caenorhabditis elegans. Annotated by 5 databases (ENA, RefSeq, Rfam, miRBase, WormBase). Matches 1 Rfam family (mir-249, RF00821). Caenorhabditis elegans microRNA cel-mir-249 precursor sequence is a product of mir-249 precurso, 249 microRNA precursor famil, mir-249, mir-249 precursor, microRNA mir-249, mir-249 microRNA precursor family, 249 microRNA precursor family, cel-mir-249 precursor, pre-microRNA mir-249 genes. Found in the Caenorhabditis elegans reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUACUCUUGAACGACUAGCAACGCACAAACGUCUUCUGUGCGACAACAUCUGAAUGUUUGUCACAGGACUUUUGAGCGUUGCCAGUCGAAAGAGGAA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.