Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae (baker's yeast) SNR17A secondary structure diagram

Saccharomyces cerevisiae (baker's yeast) SNR17A URS0000444F9B_4932

Automated summary: This snoRNA sequence is 490 nucleotides long and is found in Saccharomyces cerevisiae. Annotated by 1 database (ENA). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Fungi_U3, RF01846). Saccharomyces cerevisiae (baker's yeast) SNR17A sequence is a product of snR17a, SNR17A genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUCGACGUACUUCAGUAUGUAAUAUACCCCAAACAUUUUACCCACAAAAAACCAGGAUUUGAAAACUAUAGCAUCUAAAAGUCUUAGGUACUAGAGUUUUCAUUUCGGAGCAGGCUUUUUGAAAAAUUUAAUUCAACCAUUGCAGCAGCUUUUGACUAACACAUUCUACAGUAGGAUCAUUUCUAUAGGAAUCGUCACUCUUUGACUCUUCAAAAGAGCCACUGAAUCCAACUUGGUUGAUGAGUCCCAUAACCUUUGUACCCCAGAGUGAGAAACCGAAAUUGAAUCUAAAUUAGCUUGGUCCGCAAUCCUUAGCGGUUCGGCCAUCUAUAAUUUUGAAUAAAAAUUUUGCUUUGCCGUUGCAUUUGUAGUUUUUUCCUUUGGAAGUAAUUACAAUAUUUUAUGGCGCGAUGAUCUUGACCCAUCCUAUGUACUUCUUUUUUGAAGGGAUAGGGCUCUAUGGGUGGGUACAAAUGGCAGUCUGACAAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 1 other species

    1. Saccharomyces cerevisiae S288C Small Nucleolar RNA
    2D structure New