Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-369-3p URS0000442B0D_9913

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Bos taurus. Annotated by 4 databases (RefSeq, miRBase, ENA, MirGeneDB). Described in 4 papers. Bos taurus (cattle) bta-miR-369-3p sequence is a product of miR-369, bta-miR-369, miR-369-3p, bta-miR-369-3p, MIR369 genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAUAAUACAUGGUUGAUCUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 152 other species

    1. Callithrix jacchus cja-miR-369-3p
    2. Capra hircus (goat) chi-miR-369-3p
    3. Cavia porcellus cpo-miR-369-3p
    4. Cervus elaphus cel-miR-369-3p
    5. Cricetulus griseus cgr-miR-369-3p
    6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-369-3p
    7. Echinops telfairi Ete-Mir-154-P5_3p (mature (co-guide))
    8. Equus caballus eca-miR-369-3p
    9. Gorilla gorilla (western gorilla) ggo-miR-369
    10. Homo sapiens hsa-miR-369-3p
    11. Macaca mulatta (Rhesus monkey) mml-miR-369-3p
    12. Mus musculus mmu-miR-369-3p
    13. Ovis aries (sheep) oar-miR-369-3p
    14. Pan paniscus (pygmy chimpanzee) ppa-miR-369
    15. Pan troglodytes (chimpanzee) ptr-miR-369
    16. Pongo pygmaeus ppy-miR-369-3p
    17. Pteropus alecto pal-miR-369-3p
    18. Rattus norvegicus rno-miR-369-3p
    19. Sus scrofa (pig) ssc-miR-369
    20. Tupaia chinensis (Chinese tree shrew) tch-miR-369-3p
    Publications New