Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-369-3p URS0000442B0D_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (LncBase, MalaCards, GeneCards, MirGeneDB, TarBase, miRBase, RefSeq, ENA). Described in 28 papers. Homo sapiens (human) hsa-miR-369-3p sequence is a product of miR-369, hsa-miR-369-3p, miR-369-3p, MIR369, hsa-miR-369 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 15.5K, 1A1-3B, 1R20, 2C4D, 2F1, 2H9, 3H11Ag, 4.1-G, 4.1B, 4.1G.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAUAAUACAUGGUUGAUCUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Bos taurus (cattle) bta-miR-369-3p
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-369-3p
    3. Capra hircus chi-miR-369-3p
    4. Cavia porcellus cpo-miR-369-3p
    5. Cervus elaphus (red deer) cel-miR-369-3p
    6. Cricetulus griseus (Chinese hamster) cgr-miR-369-3p
    7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-369-3p
    8. Echinops telfairi Ete-Mir-154-P5_3p (mature (co-guide))
    9. Equus caballus eca-miR-369-3p
    10. Gorilla gorilla (western gorilla) ggo-miR-369
    11. Macaca mulatta mml-miR-369-3p
    12. Mus musculus mmu-miR-369-3p
    13. Ovis aries (sheep) oar-miR-369-3p
    14. Pan paniscus ppa-miR-369
    15. Pan troglodytes (chimpanzee) ptr-miR-369
    16. Pongo pygmaeus ppy-miR-369-3p
    17. Pteropus alecto (black flying fox) pal-miR-369-3p
    18. Rattus norvegicus rno-miR-369-3p
    19. Sus scrofa ssc-miR-369
    20. Tupaia chinensis (Chinese tree shrew) tch-miR-369-3p